Genomic Feature

em1

ID
ZDB-ALT-030617-2
Name
em1
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
spontaneous 
Lab of Origin
Fritz Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 12: 43664495 - 43664497 (GRCz11) (1) Details
Nucleotide change
GCT/C
Variant Notes
A two-base deletion produces a frameshift in codon 41 and results in a  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
1 bp inserted / 3 bp deleted (1)
Transcript Consequence
Frameshift (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
TCATCCTCATCCCGTGCAACTTTCTTAAAGCAGTCGTTTAATGACAGGTTGTGTCTTATAGAGTTCTGCCAGCCGGCTTTACTTTTCTTGTAAAAGGGAAAGTTGTCAGCCACGTACTGATAAATCTGACTGAGCGTCAGTTTCTTATCCTGCGCGTTCTGGATAGCCATCGCAATCAGCGCCGAGTACGAGTACGGCGGTCTGACCATCTTGAAAAGTTCTTGCTGACTTGATATGGAGAGCCAGCCCAAATCCGCGCTTCCAAAGCCGGTAGGAGGAGGGAGAAACTGCCGCTGGTTGGATCCAAATCCCGACTGGATATAAGAGCCTCCGTTTGGGCTTGAGAGGTACGGGGTGGAGGTGATGCCCGGGCTGTTCATCCACAGGTAAGGGTTGGTGCTCGGCGAGCTGTACTCGCCGAGCCCGTAGCTGGAGGGATGCGCAGGCGGCCTCTGGTGGTGGTGATGGTGGTGATGATGGTGCAGGTTCTGCTGGTACAT
GCT/C GAAGTTGGAGTCGCAGTACACGGTCATGTCCAGGATGTCCTGCTGCTGAAGGGGACTGGTCTGCTGGCTCGACGGCTGCTGCCCAAACGCGTTCATAATCCGCTCTCCCTCCAGAAACATGGAGTTTCTCCGATCTGACCTGCTGAGTGTGCTCGTCTCTGAGGGGTTTCTCAAGGAGAGTGTCCGGGTGCGCTTCAGGGGAGGGTTATTTAACCTGTCCGGGGCGCATGCAGTGAATGGACTCATGTTGACTACTCCTCCCACTGTCACACTTCTTCTCAATTAACTTCATCCAATATGCATCAATCTGGCGTCGAGATCATTCACGTGATAAGCTTGCCGAACAAAGACTGTTTAAGCGCTAAAAAGGGTGGACACGTCTAAAAAATGGAAGATAGTTACACTGTAAAAAAAATAAAAAATCTTAAAATAAGTTTATACGAAGTCTCACTTTTTTTGTTAAACAAGCTGTTCTAAAGCGATAGTTCACCCTCAAGTGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations