Genomic Feature

b631

ID
ZDB-ALT-030323-2
Name
b631
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
Lab of Origin
Kimmel Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 10: 43611583 (GRCz11) (1) Details
Nucleotide change
T/G
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>C (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Met>Leu at position 1 (1)
Sequences
Flanking Sequence
CCTTAAATTATTGTAATTTAATCTGACTATTTATGGATTACTTTTGGATTACTTTTATGCTTACCCCTTATTTGACGTCACATATATTAAATTTAGATGATCTTGTACTTACTACCATAGTGTAAAATAATATGTAATCTAATATGTAACCCATAAAAATGTAACTGTAGTCAGATTACAAGTAGTTTATAAAGTTGTTTACTCTAATTACAAGTGCTTGATGTTTGGAAATAATCACGATGACACTCTGTGTGCATGCGTGTGTGTGTGTGTGTGTGTGAGATGATTACTTATGAATTGTTCTCAGCTATTAATTATAAAACTAAATTTATATAATTCCTTAGATTACACGTTTATGATAATGTAATCTGACTACTTATGGATTACTTTTACATTACTTTTATACTTTTAGATTACAATTGTAACCGAAGATCTGTTTGTTTTTACCTGTCTGTTGCGTTCGTCCATTATCCGCGCAATCTGAATCTTTTTCCTCCCCA
T/G GACTTCTGTCTGTTTTTTCCTTCCTCTTCCAAAAGTACAGTCCACACTCGTCTCCTTCTCCTTCCTCTGTCGTTCCTCAGCGCAGTCTTTCCTCTTCACTCGTTCCGCTCACTGTAAAGACTCCGGCTTTCGTTCCTGAACACACAAACACACACACAGATCTCTATCAGAAAAATAGTGTGTTTCACTTAGTGCTCCAATGCGTGAAGAAACAGAGCGTTCTGGTTAACAGCGGCCAAAAATAAGAGTTTCTTGGAAGAGGAATAACAACAAATGATGTAGTTACTGTAATGGGATTCCAGTCATTTAGATCAAATCCTGTGTAAAATATGCATTTAGCATCTAATAAAACATTATTCTTATATGGGTTTGCATACAAAGAGTCCTGGAGATCTTAGTTTAAGGCATTGAGCTCAACTTTCAGCAAGATCTTATGTAACTTTAAGCTTTTTCAGACGTGTAATCCATATAAAGCTCCTTTAGCCACTAGTCGACGGTGA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
b631.pdf
Citations