ZFIN ID: ZDB-ALT-011017-18
Genomic Feature: y6
Synonyms:
Affected Genomic Regions: acvrl1
Type: Point Mutation (1)
Protocol: ENU 
Lab Of Origin: Weinstein Lab
Location: Chr 23: 27845279 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Leu>Phe at position 249 (1)
FLANKING SEQUENCE (GENOMIC)
GCACCAAAATCTATTTAGACTCATCTATTTTTGTCTTGCTTCCTTACCCAGGTCTGCAATGCAGCACTGGCCATTTCTCTTCACCAGAATATTGCGGCTCTTCAGGTCTCTGTGTGCGATGGCTGGTTTGCCTTGTGTGCTGAGGATCTCTGTGTGGAGGTGCACGAGGCCGCTGGCGATGGACAGGCACATGCGCAGACAGCCCTCCGGGTCCAGCGTGCTGTACTGCAGGAAGTCATAGAGGGAGCCCAACTCGTGGAAATGTGTGACCAGCCACAGTTGAGTGCTGGAGTTTTTAGACGTCATGTCTGATGCTATGAAGCCTTATGGACAGAGAAGTGTAAGTAAGAAATATTACATTTTAAGTCAAACACTGTGTGACTCCATCATTAGAAAAGCAATGTTTGGCAATGTCAAAACATATTATGGCTGCAGCAGTACACACAGAATGATCCCTTCCCACACGAGCAGTGAAAAATGCAGTGTGGGTGGAACTTACC
C/A
AAGATGTTTTCATGCCTTAGTTGGACCGTGTTGTAGATTTCAGTCTCTCGAAACCAAGACTGCTCATCACGAGAGGAGAAAATCTTGACAGCCACACTTTCTCCCATCCAGGTGCCTCTCCATACCTCACCATAACGGCCTTTACCTACCAGAAGCAATCAGAGCAAAAAATTCCTTTAAAGCTAGATGCATATCATTATAATAAGGTATGGCCATGACTTATAATTTTTCTGAAATTCTGAAAAAATCAAAATTAAATAATGTGTAAAGGTATACAGTAATAAATAGGTAATGATGTTGTGCTGCCAATATTGAAAAAATCTGATATTGCATTATTTTATTTCCCTGTAATGTATATTGTTATAATAATATGGTTTTACAAGATGGTTTTAAAAGTTTCAAAAGTATTCTGGTACAGAAATTGAATAATCACGATGAAAAAAATGCTTTTCTTACTTTGCTTTGTCTAGTTTCTATGGAGACCTGGAAGGGACGCAATG
(1)
NOTES
Comment Citation
The leucine substituted is within the kinase domain (five residues N-terminal  ... Roman et al., 2002
OTHER y6 PAGES No links to external sites

CITATIONS  (13)