Transcript

dre-mir-727-201

ID
ZDB-TSCRIPT-241211-2437
Name
dre-mir-727-201 Nomenclature History
Previous Names
None
Transcript Type
mRNA
Annotation Status
Annotation Method
Ensembl
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
ENSDART00000117966 [ Show ] (double-click sequence to select) [Download]
>tpe|ENSDART00000117966.2|gene_biotype:miRNA|ENSDARG00000083247.2 transcript_biotype:miRNA ncrna chromosome:GRCz11:24:26185410:26185500:1
CTGTATGTCATTTTCAGTCTTCAATTCCTCCCAGCCCGTA
CCCATCGAAACTGTGAGTTGAGGCGAGTTGAAGACTTAAA
GTGCTGTACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations