Transcript
dre-mir-430c-17-201
- ID
- ZDB-TSCRIPT-241211-2345
- Name
- dre-mir-430c-17-201 Nomenclature History
- Previous Names
- None
- Transcript Type
- mRNA
- Annotation Status
- Annotation Method
- Ensembl
- Associated With Genes
- Strain
- TU
- Non Reference Strain
- Genome Resources
- RNA Central
- None
- Note
- None
Sequence
| ENSDART00000168329 [ ] (double-click sequence to select) | [Download] |
>tpe|ENSDART00000168329.2|gene_biotype:miRNA|ENSDARG00000113369.1 transcript_biotype:miRNA ncrna chromosome:GRCz11:4:28708593:28708665:1 ATTAAGATCACTTCAAACAGGAGCATTGATTTGTCCTTTG TTCATAAGTGCTTCTCTTTGGGGTAGTTTTAAT
Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations