Transcript

cacna2d2a-202

ID
ZDB-TSCRIPT-160623-227
Name
cacna2d2a-202
Previous Names
  • cacna2d2a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000063961 (1) [ Show ] (double-click sequence to select) [Download]
>OTTDART00000063961 ZDB-TSCRIPT-160623-227 cdna:novel chromosome:VEGA67:6:53503060:53881000:-1 gene:OTTDARG00000038331.3 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:cacna2d2a description:calcium channel, voltage-dependent, alpha 2/delta subunit 2a
GACGCTCACGCCGGCGAAGACGCGCCGCTCTGCTCCTCGC
CGCTTATCGTCGCCTATCGCCGCCGGCTCTCATTGAAAAT
GAATGACTTCCGGCTACTTTGACGCTCTCGCCGCTTTCGG
TGTGAACGATGATGCACTGGGCAGGTCGTATAGAGAAGGA
GCTGGAGAAAGTGCTTCAGCTGGTCACCGGAGGCCAACAA
ATGAGAGCCATTTATAATGATAAGCGGAACCAGTTCGATG
TTGTGCGAAATACACCCAAGCAGCTGGTGGAGAAGGTGGC
AGGAGACATCGCCAAACTGCTCAACAGAAAGCGCAAGGCT
CTGGAGAGGTTGGCCAGAGAGGCTGAAGACATCCAACGAG
AGCATTCATGGCAAGATGCAATCAAGGAAAATGACATCCA
GTACTATGATGCCAAAGCCGACTCGGATGTTATGGATGAT
GATGATGGAGAAAATCTGTTGGATAATCCGAACTCTCTGT
CGCTGGAGTTTGTGGACGATCCGAACTTTAAGAATAAAGT
CAACTACTCGTATACGGCTGTACAGATTCCTACTGACATC
TACAAAGGCTCTCCGACGATCCTGAATGAGCTGAACTGGA
CTCAGTCTCTGGAGAGAGTCTTCATTGAAAACAGTCGAGA
GGATCCATCACTGCGCTGGCAGGTGTTCGGCAGCACCACC
GGAGTCACCAGATACTATCCAGCCACTAAATGGAAAGCAC
CTAACAAGATTGACCTGTATGATGTGAGGAGACGACCATG
GTACATCCAGGGAGCGTCTTCTCCAAAGGACATGGTGATC
ATCGTAGATGTGAGCGGGAGTGTCAGTGGACTCACACTCA
AGCTCATGAAAACATCGGTCATTGAAATGCTGGACACACT
TTCAGATGATGACTATGTAAACGTGGCTCGGTTCAATGAG
AAAGCGTACGCTGTGGTGCCGTGCTTCACCACGCTGGTCC
AGGCTAACATTAAAAACAAGAAGATCTTCAAAGAGGCGGT
GATGAACATGCAGGCCAAGGGAACCACAGACTACAAGACC
GGCTTTCAGTTCGCCTTCGACCAGCTGTTAAACGACACCA
GCGCCCCTCGAGCAAACTGCAATAAGATGATCATGATGTT
CACAGACGGCGGCGAGGATCGAGCTCAGGACATCTTTGAG
AAGTACAACTGGCCCAACAGAACAGTGAGAGTTTTCACCT
TCTCTGTGGGTCAGCATAACTATGACGTCACTCCTCTGCA
GTGGATCGCCTGCTTTAACAAGGGTTACTACTTTGAGATC
CCTTCCATTGGAGCCATAAGAATCAACACACAGGAGTATT
TGGATGTTCTGGGACGGCCGATGGTGCTGGCTGGAGAACG
GGCTAAACAAGTGCAGTGGACTAATGTGTACCAAGACGCT
CTGGTATGGACGATTATCATCATCGTCAGAATCATCAGCT
CAGCTAAACTGTGCTTTATTGTTTTAGCTATGACCTGCTT
CTAAAACCAAACTGATGAGAATTTGGTGGATGAGCAAATT
TCAAATTAACTGTTTGTGAAATTCGCAAATAATAACAACG
AAATGTTTTGGATGAGGAAATGGCTAAATATATGTGAAAG
TTAAAGTGTAGTAGAAATGTTTTTGGGGTTTTTAACTTTA
GCAATTAAATTACTTAAATTTGTTTGATTTCAGTTATTTG
CTAAGGCACATGTCCTAGTTAGGTTTTAAATGTAATATTA
AAGTTATTTAAAGTTTAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations