Transcript

emc4-202

ID
ZDB-TSCRIPT-160112-857
Name
emc4-202
Previous Names
  • emc4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062953 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062953|OTTDARG00000043386| emc4|OTTDARP00000049214 emc4-001 LG_1 none CABZ01101003.1,CABZ01079073.1,CU905505.4 Danio rerio protein_coding KNOWN, 346 bp
CGTTTAAGCTGCTGGAGAGCTCCAGTCAGCAGTGGCTGCA
GGGTCTGGTCTACCTCATCGGGAACCTGCTGGGCTCCGCA
TTGGCCATCTACAAGTGTCAATCAATGGGGCTCCTCCCCA
CGCACTCCTCTGATTGGCTGGCATTCATCGAGCCGCCGCA
GAGGCTGGAGATCATGGGCGGAGGGATGGTCATGTGACGC
GCACACACACACACACACACACACACACTGTTATTTAACG
TCAGCATTTTAACCGCACACACTGATGATTAATTTATATT
TGTGATTTGTGTTAGCAGAGGTCTGATTAATAACGTGCAT
TAAACTAATAAAGATTCTTTAACATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations