Transcript

hrasls-201

ID
ZDB-TSCRIPT-160112-69
Name
hrasls-201
Previous Names
  • hrasls-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000062473 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062473|OTTDARG00000043148| hrasls|OTTDARP00000048833 hrasls-001 LG_none 1 FQ323135.7,CABZ01072478.1 Danio rerio protein_coding KNOWN, 825 bp
AGTTCAGATCATTTCAGCATCAGACACACACACACACTCT
CTCTCTCTCTCACACACACAGACTGAAGCTCCAATGGAGG
ATTGAAGCTGTTCAGCCGACGATGAAATCTGCTAATACAA
TGTGCAGAATTATGCTGTGGGACGATGGATAATCAACAGA
GAAGAACTGATAATATGGCGTCAGGTGAAACTGATCACCT
TCAGTGTGTGGAGGAGCCTCAGCCAGGAGACCTCATCGAG
ATCTTCAGACCGGCCTATCAGCACTGGGCTCTGTATCTGG
GAGACGGATACATCATCAACCTCACACCTGTCGATGAAGG
TCAGGCCACTGCTGTGTCCAGTGTGAAGTCGGTGTTCAGC
CGTAAAGCTGTGGTCCGCATGCAGCTCTTGAAGGAGGTGG
TGGGTGCAGATTCATACAGGATCAATAATAAATATGATGA
CGATCACACGCCGCTGCCCGTCTCGGAGATCATCCAGCGG
GCACAGATGCTCATCGGCCAGGAGGTGTCGTATGACCTGC
TGGGCAGCAACTGTGAGCACTTCGTCACTCTGCTCCGCTA
CGGTGAAGGAGTGTCCGAACAGGCATCGCGGGCTATCGGT
GCCATCAGTCTGGTGACAGCAGCCGCAAGTGCTTTCTCAG
TGCTGGGTCTCATCAACACCCGATCCAGAAACAGACCCTT
CTAGACCTGCTGTATTCCCTCTGGAGGCGTTTGCTTTTCT
GAGTTAAGTGTCCTCTATATGCTCTGCTTCATTGCAGTGC
AGATTTACTCTGACAACTTGATATGGTGCTCAAAACTTTA
ATAAACTTGAATTGTTTGGATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations