Transcript

si:rp71-46j2.6-001

ID
ZDB-TSCRIPT-160112-511
Name
si:rp71-46j2.6-001
Previous Names
None
Transcript Type
lincRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
Note
None
Sequence
OTTDART00000062857 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000062857|OTTDARG00000043351| RP71-46J2.6|no_translation RP71-46J2.6-001 LG_none BX088596.9,AL590151.8 Danio rerio lincRNA NOVEL, 628 bp
ATCCGGTAAATCTGGATGTGGAAGTCTCTTCGACTGTCTG
AATGAGTTCTGAACCATAAGACGTCAAGATCTACATTTAT
TTTTTGATCTGTAAAGGGACGTGTTTACCTCGTTCGACTG
AGTGAGCGAAGGATGGCAACTGACCTCAGGCGGTTCATCA
CTTCCATCATAAAGCTCTGTTGTTTGTCACGCTGGAGAAT
AAACGAATGATTTGAAGGACGTGGACGAGGACTGAGATGC
TGCGAGTGGAGAGGAAGAGTGACATGAAGAGGAAAGAAGT
TCATTACTCGGCTGAAAAGGAGGCAAATGGCTTTCACAGT
CGCCTTGGGAACGGGCCTTTCTCTCTCTCACAAACCTATA
ATAAGGTACTTCAGCGGCCTAAACACAATTATTGCATGCT
AAAAAGGGAAATATTGCTTTCCAGTGTAATAGGTGGTAGA
TATTGATTCACATGGGCGTTCAAGCAGACCTTCAGTATAA
ATGTTTAATTTGCTGCTTTATTTGGATTTTGGACACAAGA
AATTTCCAACAAGAAACTTTTCTTAATCCTATTACTAAGT
TGACGTCAGAAGACAAAAAAATCTATAAGAGTACTTCTGT
TATGGTTAAATATTTTTCAAGGCTAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations