Transcript

mir7133-001

ID
ZDB-TSCRIPT-150109-2
Name
mir7133-001
Previous Names
None
Transcript Type
miRNA
Annotation Status
published
Associated With Genes
Strain
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Target Genes
Sequence
ZFINNUCL0000005724 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|ZFINNUCL0000005724|ZDB-TSCRIPT-150109-2 CuratedMicroRNAMature mir7133-001 miRNA published 22 bp
TAGTTTGATTCACAGCACAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations