Transcript

mir551-001

ID
ZDB-TSCRIPT-150108-4
Name
mir551-001
Previous Names
None
Transcript Type
miRNA
Annotation Status
published
Associated With Genes
Strain
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Target Genes
Sequence
ZFINNUCL0000005708 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|ZFINNUCL0000005708|ZDB-TSCRIPT-150108-4 CuratedMicroRNAMature mir551-001 miRNA published 22 bp
GCGACCCATCCTTGGTTTCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations