Transcript

lcn15-201

ID
ZDB-TSCRIPT-141209-91
Name
lcn15-201
Previous Names
  • lcn15-001
  • ch211-272f14.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023398 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023398|OTTDARG00000019126|ZDB-GENE-060825-349 lcn15|OTTDARP00000047977 CH211-272F14.3-001 LG_ BX927256.14 Danio rerio protein_coding NOVEL, 1142 bp
GTTCTTCGCTTCTCCAAACAGAGTTGTTTAAGCGTTCATC
ATGACTTTAGCATTAGCCCTTTTGTTTGGCCTGTTTTTAG
GAACGCACAGTTTCAACACACCGGATCCAATTGGACCTCA
GCCCAACTTTGACCTGGAAAAATTTGCAGGTGAATGGTAT
CGGCTTGGGCTTGCAGATGAATCACAATTTTTCGCAATGT
TCAAAAGTCATCTGAAGGTTTCTAAAGGTCTTCTGGTCCC
GGATACCAGTGGAAATGTCAATCTGACTATGTGGACTATG
AGGCCGTATGGATGCTCCATCAGTGTGTATTCATATGAGA
AGACAGATGTTCCTGGAGAATTCACTTACTTCAGCAAAAG
GAACCAGATTACAAAAGACGTCACAATTGTGGAGACAAAT
TACACTGACTATAGTTTGGTCCTAAAATACAAGACCATGA
ACAAGGAATACACTCAAGTAGCTCTTTATGGACGCTCCTC
CACACTAAGGCCAGATTTAATCGACAAATTCAGGTCTTTT
GCTTTATCTCTGGGCTTCTCCGAGGAGGCTGTTATCACCC
CAACAGATATTGATCCCTGCCCTAATCTAGAACCAAGCCT
GCTGTGGAGTGAGACCTTGGGTTACATATATTCACTTTTG
TTACGCGTTTGGGGAACAGTGTTTGTTTTTACACAAACTG
TCATTGGAGAAATGCAACAGTATTACATCTTCAATGTAAC
GCAGGCTGTGCTGCATTAATGAAACAGCAGGTGGAGCTGT
TGGAACAGGACTTCATACATTACTGTTAAAGCTCCTGTAG
TGCTCCATCTGACTACTACTGTTATTACTAATACTACTAC
TCATAATAATAATGGACGTGTATTACTGTGGTTACTTGAT
AAATGTTTACACACAATTTGTTTTAATTATAGTGGTGCTT
TTACGATCAAACTGTATTTGTAAATTGTGTAATAAAACAA
ATATTTTAATTCATAAAAACCTATAGACCTGTTTTAGGTT
ATGGTTGTATGTGGTGCAAAACAAATGGGCAAATTGTATA
TTTTGTATGTTTGTGTATTGAAATTGTACATTTGTGTTTG
TGATTTTTAAACAACTTTATCAGCATGTTTATTTGATTAA
AATACAACAATATTATAGTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations