Transcript

cdh4-202

ID
ZDB-TSCRIPT-141209-877
Name
cdh4-202
Previous Names
  • cdh4-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061153 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061153|OTTDARG00000020365|ZDB-GENE-991207-1 cdh4|OTTDARP00000047335 cdh4-002 LG_none BX640470.7,BX571709.23,CU914616.5,CU633621.14,CU633475.6,CU861475.7 Danio rerio protein_coding KNOWN, 4190 bp
CAGTAGGGCGCGAGACCGACCGGGACAATATTCTCTCGCA
TCACTCAGCGGAACCTGCTACCGACAGCACATCTCACAGG
AATTATCTGCACGTTTGTGAATAACAAACATCTGCCTCCT
TCGCTGATGGCCAAAATGAAAACCGGCTGCGCGATTCTTG
TGGCGTGTGCCTTAGTTGTGGGCACATCTTTGGGGAGTCA
CTGGAACGCTCAGACGGTTGCTCCATGCAGACCTGGCTTC
TCCCAGAGCTTCTACACCGTATTTGTCCCCAGGGTTGTGC
TGCAAGGCCTGAACATCCACAAAGATACCCTGCTGTCATC
TGGCCATGTGAAGTTTGAAACCTGTCACCGAATAGAGGAG
CTTTCTTTTGAGAGCAGTGACCCAAAGTTCAGCGTTCGGC
CTGATGGCTCTCTTTACGCAGAGCAAGATGTGACGAATCT
AACAGAACCCATCCAGTTCATGGTGACAGCCAGAGACAGA
GCAGGAGAGTATATCTGGGAGACCACTGTTAAACTGGCCC
TCGCCGGACACCCACTTTCACCTCCTTTTAACCAGATTGC
TGGCGAAGCCATTTATGGAGGACCCTCCCACTACCACTAT
CAAAATCCCCGGCTCATTACGTTTCCACGACAACGGCAGC
GAGGCTTATCCAATGGGCTGCGGCGACAGAAGCGGGACTG
GGTCATTCCACCAATCAACGTGCCTGAGAACTCCAGAGGG
CCTTTTCCTCAAGTCCTCGTCATGATTCGATCGGACCAGG
ACAAAAAGATTGAGATCCGGTACAGTATAACAGGAGCTGG
AGCAGATCAGCCTCCCAATGACGTCTTTAATATTGATCCT
GTGACAGGGAAAATGTCTGTCACAAAACCTTTGGACAGAG
AAGATAGAGCTTCTTACCATCTCAAAGCTCATGCGGTGGA
TATTAACGGGAACCAAATGGAGCCTCCTATTGATCTGTAT
ATTTATGTCATTGACATGAATGACAACAGACCCGAGTTTA
AGAACCAGGTTTACAACGGATCAGTCGCTGAAGGCTCCAA
ACCTGGCACTTCTGTAATGCAGGTAACGGCCTTTGACGCT
GACGACAGCACCACGGCGAATGGACTGGTGCACTATCGCA
TCCTGAGCCAGACGCCTCACATCCCCATTCCCAACATGTT
TACAATTAACGGAGCCACCGGAGAGATTAGCACCATCGCA
GCGGGCATCGACAGAGAGAAAGTCTCTCAGTACACCGTCA
TAGTGCAGGCCACTGATATGGAGGGAAACTTGAACTTCGG
TTTGTCCAACACCGCCACAGCCCTCATCAGCATTTCTGAC
ATCAATGACAACCCGCCAGAGCTGGACTCTAAAACTTTTC
TAGGAGAGGTCCCGGAGAATGCTGTGGGTGTTGTGGTGGC
CAATTTGACAGTCAGAGACAAGGATCAGCCTCATACACCC
AACTGGAATGCTGTATATAGGATCACAGGAGGAGACCCGT
TGGGCCATTTCACCATACGCACTGATGAAATCACCAATGA
TGGCAGGGTCATAGTGGTTAAGCCAGTTGACTATGAGCGG
AATGGAGCCTTCATGCTCATGGTGGTGGTCTCAAACCAAG
CTCACCTGGCCAGTGGGATCCCCTCCTCCCCATCTTCCTC
TGCTGGTGTCACCATCACAGTTTTGGATGTCAATGAGGCT
CCTGTCTTCCCATCCAACCCTAAAATCATCCGCTTTGAAG
AGGGAGTACCTGCTGACACCACCCTCGCTACTTTCGCTGC
TCTGGATCCAGACCGCTTTATCCAGCAAACTATCAGGTAC
TCCAAACTGTCAGATCCAGCCAACTGGCTGAAAATCAACA
GGACCAATGGAAGGATCACCACCACCGCGGTGCTGGACCG
TGAGTCACCGTATATGAAGAAGAACGTATACGAAGCAACC
TTTCTGGCCGTGGACAATGGTTCCCCTCCTGCCACAGGAA
CTGGTACACTCCAGATTTATTTGATAGATGTGAATGACAA
TGTGCCCGTCTTGGTTCCTCAAGAGGCTCTGGTTTGCGAG
AGGTCACGACATGGATATCCAGTCAACATCACAGCCTCAG
ATTTAGATTCAGAACCCAATGCTGGCCCTTATGTCTTTGA
GCTGCCCTCTTACCCCTCTTCTGCCCGTCGAAATTGGACC
ATTTCACGCCTGAATGGTAATTATGCCCAGTTGAAACTGC
GGATCCCCTACCTAGAGGCAGGCATGTACAGAGTCCCCAT
TTTAGTTTCTGACTCTGGAAACCCTCCCCTGTCCAACACC
TCCGTCCTGAAGGTCAAAGTGTGTCCCTGTGATGAAAACG
GAGATTGCACTGTGATCGGTGCAGTGACTGTGGCTGGGCT
GGGAACTGGAGCCATCATCACCATCCTCATCTGTATCATT
ATACTGCTCAGTATGGTTCTGTTCTTCGTGGTGTGGGTGA
AGCGAAGGGAGAAAGAGCGTCAGACAAAACCCTTATTGAT
CGACCCTGAGGATGACGTCAGAGATAACATTCTGAAGTAT
GATGAAGAGGGAGGAGGAGAGGAAGATCAGGACTATGACC
TCAGTCAGCTGCAGCAGCCCGAGTCTCTAGATCACATAAT
GAGCAAGCCTGCAGGTGTGCGGAGAGTGGACGAGAGACCC
GTTATCCTAGAATCTCAGTATCCTGTCCGGCCAACGGTAC
CACACCCAGGAGACATCGGGGAGTTCATCACTGACGGTTT
GCGTGCAGCAGATAATGACCCCACCGCTCCTCCCTACGAC
TCCCTGCTGGTGTTCGACTACGAGGGCAGCGGCTCCACAG
CGGGCTCTGTCAGCTCCCTGGACTCCTCCAGCTCTGGGGA
ACAGGACTACGACTACCTCAATGACTGGGGTCCTCGCTTC
AAAAAGCTGGCAGACCTCTACGGAGGAGGGGGGGAGGACT
GAAGGTGCGAGCCAGAGGAAGACGGAGGGGAACAGAGGGG
GCCAGGAGGGACTTTTGGCATCTCGAATGTTTTATCGAGA
AGCTGTACGCCAAGCCTCCGAAGTGGGCTGATTATCTCTC
AAGAAAAGTTCCTCTGCACGCTACGGAGGCACGGAGAGGG
GAGGATATTGCCCTGCAGCCTGCTCTGGACCTTTGCTGCA
ATCCACAAGTATTTTACGGCTTTTTACAATATTTCGCGTT
GTGGTTTCTTCAGTGTTGTTTTGTCATTCCTCTCGGATGG
CCTAAAGGCTCAAGATGGAATCGAGTTGCGATGGGGACAG
CGAACTCTCGGCGCGCAGGAATCAAAGAAAACGAGTGCGC
ACACTTGTTTTTTTTCCAGTCGCTTTATCACTAATGAGAG
CTCCACACACACTTTTTCTCTCAACTTGAATTTCAGTAGA
ACAGAAGCACTGTTGTTGATAAAGTGCCTTTTGTGGTGTG
TTTTGTATCGGACTCCTGCAATCTCAGGGTCGGTTGCCAT
TTTGAAAAGTTTCTTCTGTTGGGCGCACACTCCCCCGTTC
CTGTCTGCTCCTCTCAGCTACCTTCTGCTTTTCGTTCACC
TCTGCATTAGCGGTGCAGAACGCCTCTTTGACTACTACGT
GGAAAACAAAGGAAACAGAGAATGTTTTGTTGACAAACAC
AAGACTCATCTTCCCTTAAGCAATCTCATTCTCCCTTGAG
AAATTGGAGCGTATAAAGTACAGTGATCCAATTCGACCAA
AAAAAAAAATCATTTTTCTTTTCTTTTTGATTATTTTTAT
TTTAAAACTTGACCGACCACGACCATATAATGTTATGTTG
TGTAATGGTTGTGTAAAAAAAATCAAGTTCTTTATTTTAA
AAGAAGAAAAATATTACTGGAGAATGCCTTTTAGCTCATA
CTCTTGCCTGCCTTGTACGATTTTGTGTTGCGTTTCCGAT
CTGTAAAGGTAATTTAGGCATGACAAGTTGCCAGACAGTG
AGACTAAAAGTGATGGCTGAAGAAACCCGACTCTAAAAGG
ATTGCATCAGAAGAAACCTTCTCTTTTTTTGTCTTGAACA
TTCCCCTTTTCTAACTTTATAAGTTGATTAAAATATTATA
CGTGCATGACTTCTTTCAAAACAATGTCTCAAATCTCTCG
CACTTGTTCCTCTGTGGTCAGAATGTGAAAAGTAGTTGGC
AAAGAATATACACCATACGGAATAAATATAATCTGAAAGA
AATAAAAAACAAACAAAAAAGATTCAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations