ZFIN ID: ZDB-TSCRIPT-141209-841
Transcript Name: si:ch73-380l10.2-201
Previous Names: ch73-380l10.2-001, si:ch73-380l10.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061033 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061033|OTTDARG00000042315|ZDB-GENE-141216-416 si:ch73-380l10.2|OTTDARP00000047165 CH73-380L10.2-001 LG_ CU672227.10 Danio rerio protein_coding NOVEL, 608 bp
ACTAGTTGCTTTATTCTCCACACTTCCAGTGACCGACAGA
CAGCGGACTCTCTCCAGTCATGACGAGCTCTGAGATGCTG
ATGACAGGACTCCTCGTAGCGGGACTCTTCACCGTCCTCT
GCTCTGGACAAACTTCCCAAGAACTGACCTTTGATGACGC
ACAACTGTCCCCGCAGGAAACAGAGAATCAGCTGGTTGAG
GCTATGACAGCACTTTTGGAGAGATATCAGAGCCATTTGC
CATCTTCAGAAAAACGAGCCATTCCACAGTGTGCTTTGGG
GTCTCGCTGCGCCATGAGACTGGGGTCACGCTTTGGAAAA
TTGTGTGAATGTGGCAGAGGATCAAACTGTAACTCATTTC
TCTTAAAATGCATCTGAACTGAATCTGGAAAAAAGGCAGC
TAATCCATAATCTTTTCTTGAAGCAGTAAAGTAATGCTCA
AATGATGACCTGAAAGAGGCAGAGGCTGGAAATCTGTTTT
CTGAATCACTTATATACGACAAGAGGATCACACAGCATGA
CAAGCCAATAAAAGCATGAGTTTTTTTATCTCTATGTATT
TATTTTTTAAAGGGCTGTTATGTTATCAATAAACATTATT
ATTCATCA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-380l10.2-201 Contained in:
[BAC] CH73-380L10 (1)

Genome Resources: Vega_Trans:OTTDART00000061033 (1),  Ensembl_Trans:ENSDART00000165037 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH590817 (1) 628 nt
GenBank:EH608295 (1) 611 nt
GenBank:CT730296 (1) 581 nt
GenBank:CT730295 (1) 559 nt
GenBank:AL917053 (1) 539 nt
CITATIONS (2)