Community Action Needed: Please respond to the NIH RFI
Transcript

tmem136b-201

ID
ZDB-TSCRIPT-141209-3550
Name
tmem136b-201
Previous Names
  • tmem136b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061902 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061902|OTTDARG00000042836|ZDB-GENE-040718-455 tmem136b|OTTDARP00000048409 tmem136b-001 LG_ BX248506.10 Danio rerio protein_coding KNOWN, 1140 bp
GAGCAGAAGAAGCATTGTGGTTTACGCTGTGATTGTGTCT
GTCTGTCATGTCACACCACTTTCAGGACAGGAAGGGTTGT
TCTGGTGTCACTTGCGGTTGAACACCTCGACGCAATGCTG
AAATGGACTGAAGTTGCAATGGGTTGAGGAGAAGTGGATT
TACTGGGATGCTAAGATCCGTGTGCAAGAGTTGTTTCTGA
GAGATGCCTTTGTTTATAGTGGAGACAAGCTGCAGCCTGA
TTAGCTGGCTCTTTCTGTACCTGTTGCTGTGTCACTTGAA
CAGTGGGAGGGACTCTGAGTGGAACTGCAGGCTGGTCACT
CTGTTTCATGGCATCCTGATTATCTGTCTGACTGCTTACA
TTGGCTTTATTGCTGGGCCATGGCCTTTCACACACCCAGG
CACAGAAAACACATACTTCCAAATCCTGACTCTAGTTCTC
AGCTTGGGATACTTCCTCTTCGACATGGCCTGGTGTGTGT
ATTTCCGTACAGAGGGTCCGGTGATGTTGGCCCACCACAC
CATGAGCATCTTTGGAATCCTGCTGGCACTGGGACTGGGT
GAGTCAGGCATCGAGACCTGCGCCGTCCTCTTTGGCAGTG
AGATCACCAACCCACTCCTGCAGGCGCGCTGGTTCCTCAA
GCGCATGGGATGCTATGACAGTTTAGCTGGAGATGTGGTG
GACCTACTCTTCATTCTTCTATTTGCCTCTGTGAGGATCG
GCGTTGGAAGCAGAATGCTGTACTGCGAATTAACATCTCC
AAAGCCATCGCTAATTGTCAAAGTTGGTGGGGTGGCCATT
TACACTCTCTCATGGATCTTCATGGTAGACATTGCACGGT
TTGCTTGCAGGAAAACTTGTGGTAAATACAGGCGATGGAA
GGAACAGTACAAGCTGGATGGTGTTAACGGACATGCTGTT
AAAATAAAATAAGCCATTCTGTGCATTTGAGTTGAAAATA
ATTTGCATATGCTTCTGTGTGTATCTAGACTCTTTGCAAT
TGAACAGGATTTGTATACCTTTATTGCATTTCCAGAACTT
TTTACTGCATATGAATATTTATATAGTTAGCAGTTTATAT
TCAATAACAACTATCTCAAAAAGATTTTCCATTATAAATA
AATGTTTCATTCATTATTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations