Transcript

ugt5b4-202

ID
ZDB-TSCRIPT-141209-329
Name
ugt5b4-202
Previous Names
  • ugt5b4-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051823 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051823|OTTDARG00000036402|ZDB-GENE-070112-2332 ugt5b4|OTTDARP00000040721 ugt5b4-003 LG_ CU104756.12 Danio rerio protein_coding KNOWN, 1801 bp
TGGTAATGACTTGCATCCCACCTGTACATATTAATGGGTT
TGAATGCCATCACAACCAAGGTTTAAAGGCTATCTAACTA
ACGCAAACCAGGAACTATGAACAGAAAGGTTTTTCACATG
CTTTGGCCAGTCACATTATGCCTTCTACTAGTAATGGCTC
CAGTTGTTGAGAGCGGGAATGTTCTTGTCTTTCCTGTGGA
TGGCAGTCACTGGGTCAACATGAACATCTTGGTTGAAGCA
CTTCATGCCAAAGGCCACAATATTACAGTCATTCGGATGT
CAGACAGCTGGTACATCAAAGAGTTCTCACCTCACTACAC
ATCAATTACACTAAAGTCTTCGGGAGGATTTAGTGAAGAC
ATCCTTGAGACGTTTGCATCCAGACTTATAACCATTTTAA
GGGACGGTTCCACATGGGGTCGTCTAAAGTTAGAGATGGA
GATGTGGCAAAGTTCATTAAAGATTATGGAAACAGAACGT
GAGATGATAATCAACATGATTGAAGATCAGCAGCTTATAG
ATTCTTTAAAAAAAACAAAGTACGATTTATTTCTTACCGA
TCCTGCCATGTACGGAGGGGTCATATTGGGTAACTATCTT
AAACTGCCCATTGTTTACAATGTCCGTTGGGCTATTTTTG
GTGAAGGTCATTTTGTTATAGCTCCATCTCCACTTTCTTA
TGTTCCTGTTGCAATGCTAGAGTTACCAGACCGCATGAGT
TTCTTGGAAAGAGTTAAGAATGTTGTGATGTACATTATAA
CAGAAACACAAATTGCCTTTTTGATTGCCCCAACTTACAA
TGTTCTCTGTGAACGCTTTATTGGCCCAGGAGTAAATTTA
TTCAACTTAGTTCAGGGAGCTGATCTGTGGCTCCATAGAG
CTGATTTTGTGTTTGAATATCCACGTCCCACTATGCCAAA
CATCGTCTACATGGCAGGTTTTCAATGCAAGCCATCAAAG
CCTCTCCCAAAAGATCTGGAGGACTTTGTTCAGAGCTCGG
GTGATCATGGTGTCATTGTCATGTCTCTGGGAACTATAAT
TGGTCAGCTTCCCGATGATGTGGCCGAGGCAATTGCTGAA
GCCTTTGCAGAACTTCCACAGAAGATCATCTGGAGGTACA
AAGGAAAGAGACCGTCTGCACTAGGAAACAACACTTTAAT
AATGGACTGGATGCCTCAGAATGATCTTCTGGGTCATCCC
AAGACCAGAGCCTTTGTTGCACATGGAGGAACCAATGGAG
TTCAAGAAGCCATCTACCACGGGGTGCCAATCATCGGATT
TGGCCTGATTTTTGATCAGCCTGACAATCTTTCTAAAATG
AGAGTGAGAGGTGCAGCCAAGAATGTAGACTTTGCCACAA
TGGATAAGGAGTCATTCCTTAAAACGGTCAAAGAGGTACT
CTATGATCCCTCTTATCGGGAGAACATGCAGAGACTCTCA
AGGCTTCACAAGGACGTTCCAGTGAAGCCTCTGGACAACG
CCATCTTCTGGATTGAGTTTGTTATGAGACACAAAGGTGC
CGCTCACTTGCGCACAGAGTCGTACAAAATGCCCTGGTAC
TCTTATCACTCTGTTGATGTTATTCTAGTGCTGATTTCTG
CTGTGTCACTCATAATCTTGAGCATATATGCAGTTATCCG
ATATTTCTGCTGCAAAATATGCATGAGAAAAACAAAAATC
AAACGTCAATGAATTTGCTTTTTTAGCACTTGATTTTAGT
AAATTATGTTAATAAATGTTTTAATTACATAATACAATAA
TTACATAATCATTTCAGACAGGAGCAGACAAAAACATCTG
C

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations