Transcript

chrna4b-201

ID
ZDB-TSCRIPT-141209-3230
Name
chrna4b-201
Previous Names
  • chrna4b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060861 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060861|OTTDARG00000042194|ZDB-GENE-090505-3 chrna4b|OTTDARP00000047039 chrna4b-001 LG_ CR762408.7 Danio rerio protein_coding KNOWN, 2265 bp
ACTTTTACAAGAGGTTTGGGCGCTGAAAGACTTTTTGTGG
CCTTATTTAACACACTTTTGACTCAGTTTTTGGAGTGATG
ATCTACTGGTCTGTTCAGAGATTTTTTTATGATCAAAACT
GGACGAAGATTTTTATTCTTTAGTTCCTATGCCGAAATTC
TTCCAGAGTTGAATATCATCTGACATAAGAAAATGAGAGC
AGCGTGGAGGGTCTTCTTTCTTCTGTGCGTCCATCTGCAA
CTGGCGTATGTGTTTTCCATGAGCCCAGCTCATGCCCATG
CGGAAGAAAGACTCCTCCAGTCTTTGTTCATCAACTACAA
CAAGCTTTCACGTCCAGTAGCAAACATCTCTGATGTGGTT
CTGGTCCATTTCGGCTTGTCCATTGCTCAGCTCATTGATG
TGGATGAGAAGAATCAGATGATGACCACAAATGTCTGGGT
GAAGCAGGAGTGGAACGACTACAAGCTGCGCTGGAACCCA
GAGGAGTATGAGAATGTCACCTCCATCAGGATCCCCTCTG
AGATCATCTGGAGACCGGATATTGTGCTCTATAACAACGC
GGACGGAGACTTTGCGGTGACTCACTTGACAAAAGCTCAG
GTGTTTTACAACGGGAGAATCAAATGGAAACCTCCCGCCA
TCTATAAAAGCTCCTGCAGCATCGATGTCACCTTCTTCCC
CTTTGACCAACAAAACTGCAAGATGAAATTCGGCTCTTGG
ACGTACGACAGGGCCAAGATTGACCTGATCAGCATGGCCA
GTGACGTAGACCAGATGGACTACTGGGAAAGTGGCGAATG
GGTGATAATAAATGCAGTTGGCACCTACAACATCAAGAAA
TACGAGTGCTGCACTGAAATCTACCCAGATATCACCTACT
CTTTCATCATCAGACGCCTTCCTTTGTTCTACACCATCAA
TCTCATCATCCCCTGCCTGCTAATCTCCTGCCTGACAGTC
CTGGTCTTCTACCTCCCCTCAGAATGTGCTGAGAAAATCA
CGCTGTGTATATCTGTCCTCCTATCCCTGACTGTCTTCCT
CCTGCTAATCACCGAAATTATCCCTTCAACCTCATTGGTC
ATCCCACTGATTGGCGAGTACCTACTGTTCACCATGATCT
TCGTCACTCTGTCCATCATCATCACGGTGTTTGTACTCAA
CGTGCACCACCGTTCGTCTCGTACGCACAGCATGCCACAC
TGGGTCCGTCAGCTATTTCTCCACCTGGTGCCTCGTTACC
TGTTCATGAAACGTCCACCAGCCTCGGGCAAGAGAAACTG
CGGGAAGCTGATTGAGATGATGCACAAACAGGCTAATTCG
CAATCTATGTTTCTGCGGAACAACATCCTGGATATCTCTC
CGCAAAGTCCGATCCCGCATTTGGGACCTACTTCAGCTGC
CCAGCAGGATCAAGTTCAGCAGGACTCAACTTCCCCCAAA
CCCCTGTTTTTCTGCAGTTCCCCCAGCAGCCAGTATTCAA
TCCTTCAAGAGGAAAACTCACAAACCCCCCAAACACCAGT
TCTCAGCTACACATGCGCATATACAAACAGCATCTTCGCC
TCCAGCACAACTTCCTTTCCAGATACTCTCCTTGGCACCC
TGCTGCACACCATACCGCAGGACGGAGCCAAGAGCACAGA
ATGCGATTTCCAAGGCCACAGTGCTGAGAGTGTCTTCATG
GAAGCCAAGGAGAGTGTTCTGGGAGCAGGGAGTTGTCAAC
ACTGCCTTACGTCTGAAGGGACGAGTCTGCAGAAGCTTGA
TCTCGATGAGGCAGGGAGGTGTACCAGACATAACATGCCC
AGCGCTCAGATCTTCAGCCCCAGCAGTGACGGCTCCACTG
ATCTGAATGCAGCAGAGCCAGTCAGCAATCTGTCTCAGTC
CCTGCTCAAAGCCTTGGAAGGAGTTCAGTACATCGCTGAC
CATCTCAGAGCCGAGGATTCAGACTTTTCAGTGAGGGAAG
ACTGGAAATATGTTGCCATGGTGATTGATAGAATATTCCT
CTGGATGTTTGTGCTGGTGTGCATTTTGGGGACCGTCGGA
CTGTTCCTCCCTCCGTGGCTCGCTGGGATGATCTAGAACA
TCATGCGGAGTCTTTAACTGGCCTTGTCAATCACACTTGA
CTGCAGTGACCTCATTAAACATCCGCTGGCATGGAAATTA
AGTGATGTTTAATGTCAGTGCTTTTTTTTATGTAACAGGA
AGTTATTTATGGGATTCTGTTTTGGGTTAAATGTGAGTTG
ATGATTAATTAAATGAAAATTGATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations