Transcript

slc2a10-201

ID
ZDB-TSCRIPT-141209-2745
Name
slc2a10-201
Previous Names
  • slc2a10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050778 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050778|OTTDARG00000035659|ZDB-GENE-080204-6 slc2a10|OTTDARP00000039870 slc2a10-001 LG_ CU928126.8 Danio rerio protein_coding KNOWN, 2287 bp
TTTGTCCCAATAGAGCTCATACTGTAGAGTTCACAGCTCC
TGCCACGTCGCTGCTGCAGTTGCACTTCCTCAGATGAACA
GGAGAAACTTCCAGCGAACTTTCCAACAACAAAAGACTGA
TGTAAACCCCGGATACAGAAGCTTTTCTATTATAAACTCT
GACTATGTTTTATCTTCAGCGATGTCCAGTTTGATATCGG
GATGAAACATCTCTCCTGATGTGCTGAAATGTGAGTTAGC
GGTTGAGCTACTTTTAGTTCTACCTCCGCCTTTCGTCTTT
TGTTTTTATCCTCGCTCCTTAACAGGCTTGAGATAACTGT
CCAGCTACAAATGGACTCTATAAACTCTACAAACAAGATC
TCCAGGGTCAGCACTGGAGGTAAAAACACATAAACACGAA
CTCGGGGATATTTTTAGCTAATGAGAAGCGCTTTCAAGAG
CTCCTCATCTGATTGAATCACAGTCGTCATGGCGACAGCC
CGACACTGATTACAGACCAGACTGAGCTTCAGTTCGGTTT
CATTCACTCTCTGTGTGTTTGTTATGATAATAATAGATGA
TGTTCGCCGACGAGGCAGACTTGTTTCGTATTTGATGAAG
CAGCATCTTTAAATTCTCATCAAAATGGGTTGTTCTGTCC
TGCTCCTGACCATCACTGTGTCCACTCTCGGTGGTCTGGT
GTTCGGCTATGAGCTGGGAATTATATCCGGTGCTCTTCCA
CAGCTCCAAACTCACTTCTCTCTGGGCTGCGTCCAGCAGG
AGGCCGTGGTCAGCGCTCTTCTGATCGGATCCCTCTTTGC
GTCAATAATCGGCGGCTGGTTGATCGACCGCCATGGCAGA
AGAACATCAATCTTACTCAGCAATCTCCTCATCCTGGCCG
GCTCCGTTATTTTAACTACAGGCACATCCTTTTTCGCACT
GGTCATCGGTCGGGCTGTTATTGGCTTCGCGATGACCGTT
TCATCAATGAGCTGCTGTATCTTCGTCTCGGAGATGGTCA
CTCCTGAACGCAGAGGATTGATGGTGACTCTTTACGAAGT
TGGGATCACGGTTGGCATCTTGATAGCTTACGCCGTCAAC
TATATCTTTAATAACGTGCCATTAACAGGCTGGAGGTACA
TGTTTGGATTTGCTATTATTCCATCACTCATCCAATTGGC
ATCCATTGTGCTTCTACCAAAGCAAGCTGAAGTCTTCGTA
ATACATGATGATGATAGTCGGCAAGCTGATAGATTAACAG
AGGAAACGGAAACATCAAATCAGCATCAGCAAAGTGAGAA
ATATGGTGTTTCTGACCTTTTTAAAAGCAAAGATAACATG
CGGAGGAGAACGGTGATTGGTGTTGGGTTGGTGCTGAGTC
AGCAGTTCACAGGTCAACCAAATGTGCTCTTTTACGCCTC
AACTATACTTTTCTCTGTCGGATTTCAAAGCAATGCTTCT
GCAATCCTTGCGTCTGTGGGTTTCGGGATTGTTAAGGTCA
TCGCGACTCTACTAGCGATGTTGTGTTCAGATCGAGCCGG
CCGGAGATCACTTCTGATTGGTGGATGCTCGATGTTGGCT
GTAGGATTGATTCTCACTGGATTTCTATGCAGACAGTCAG
TGATCGACACAACGAAACGATGCACTTCAGTAGGACCGCA
TTCAAATCTGACGTTATCTGCTGAACATGACGAAGGCGTG
GGGTTCAGCTCTCAAACTCTTGATGTTCATGAACATTTAC
GGAGTTTTTCGCAGTCGGAGGACATTTATAAGTGGATTAT
TTTCACTTGTTTGATGGCGGTGGTGAGCGCTTTCTCTGTG
AGCTTTGGACCAATGACGTGGGTTGTGCTGAGTGAAATAT
TCCCGAAGGACATCCGAGGAAGAGCCTTTTCCTTCATCAA
CTGCTTCAATGTGGGCGCAAACCTCATAGTCAGCTTTTCT
TTCCTGAGTATAATCGATGTCATTGGCCTGTCTGGAGTAT
TCTTGATGTATGGAGTTGTAGGAATAGCAGGCGTAGTGTT
CATCTATCTTGTTCTACCAGAGACCAAAGGAAAATCTCTG
CAGGATATCGACCGAGAGCTCTCTCAGACACGAATGATCC
ACAGACAGGAACTGTGCAGCATTTTCCAAAGACGGCGCTT
TTCTCCAGGCTACCAGAGAGTTCAGCTGACGAGTACAGCA
ACCTGATGAAGTATGTTGACGGCATCATTCAGTTCATGAT
AATGGCTATTTGTGCTGTACCGTTTGATAAATATTTATGA
AATCCATGTGCTTTTGCCATTATAATTTTAAATAAAGTCA
TCTCTAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations