Transcript

fgf20a-201

ID
ZDB-TSCRIPT-141209-233
Name
fgf20a-201
Previous Names
  • fgf20a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000046470 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000046470|OTTDARG00000033122|ZDB-GENE-060110-1 fgf20a|OTTDARP00000036646 fgf20a-001 LG_ BX927112.17 Danio rerio protein_coding KNOWN, 1107 bp
TGAAACCGATCATCAAAGAAGACAGAAGAAGGGGATCCAA
ACGATCAAGGAGTTATGTTTCAAACAGTCATCTATAAAAG
GCTCCATTAGCATATGTCAAGAGGGCCATTTACATAAGGG
CCATATTTAGGCTGGTGTCTCAGAGCAGAGGCAGTCACAT
CCAGAGAGCACAAGAGGAGAGAAGCCGCATAAGCTTGAGT
GTGCTGGAGTGCGTAACAGAGAGAGTATTGGATACACGGG
GGACCGGAGCAAAGGGGAGTAGCCTGGAAGGTCGAGAGAG
CATGTGCTGAACCTGAAGCGAGCGAGAGAGAGAGAGAGAA
TCGGATGTAAACACGCATTGACTGTCAAAGCCGCAAGCAG
TGACTGCGCAAAACACCAGGGAAAGAGAAACCACAGGGGT
TCTCCTCGCGGTAACTTTTCTTCGAGTGTCGGTGATGGGT
GCAGTCGGCGAGCTGGTGGGCAGCTTCTCTCACGGCTTGG
AGAGCTTTGCGCACGGGTCTCATTTCGTCCTCACGCCCCC
CGGGGACTCTGGTGCGCTGATGAACGAGCACCTCGTCTCC
GCCGAGCGCCTGTCACGCAGCACTTCACCGGACCTGACGC
ATCTCAAAGGGATCCTCCGTCGGCGGCAGCTCTACTGCAG
GACCGGCTACCACCTCGAGATATTACCGGACGGTTCGGTC
CAAGGCACGAGGAAGGACCACAGCAGATTTGGTATATTGG
AATTCATTAGCCTCGCTGTGGGGATGGTGAGCATCCGTGG
TGTGGATAGCGGATTGTATCTGGGAATGAACAGCAAGGGC
GAACTGTACGGATCTGAAAAGCTGTCAGCCGAGTGTGTGT
TCAGGGAGCAGTTTGAGGAGAATTGGTACAACACTTACTC
TTCTAACCTGTATCGGCATGGCGAGCGTGGATCTCATTAT
TATGTAGCCCTCAACAAAGATGGGACGTCCAGAGATGGGG
CACGCTCCCGGAGACACCAGCGCTTCACGCATTTCTTACC
GCGGCCTGTGGATCCAGAGCGAGTTCCTGAGCTTTACAAG
GATGTTCTAGGTCACAGCTGAAACCAATGAACCTCAAACT
CAAAACCACCCCAAAAAGCACCTGCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations