header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-2274
Transcript Name: si:ch211-14c17.4-001
Previous Name: ch211-14c17.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061730 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061730|OTTDARG00000042727|ZDB-GENE-141216-81 si:ch211-14c17.4|no_translation CH211-14C17.4-001 LG_ CT027631.14 Danio rerio antisense NOVEL, 803 bp
CGTTTTAGAAAATAGTTTGTAATAATAATATTCAATGGAA
TAAATGTGATTAATTTAGCTGGAAATCTTCAGGAAAGAGG
AGTATTATTCTCTGAGTGAACATAAATCCGACAGATGGCG
CTCTCCGCTTATAAAACCGACACTGAACAAGAAACAAACG
ATATATATAAATGCGAAAGTCCTTCAGGCTCTGCAGCGAA
ACGCTGAGGTGATTGGAAGACAGGAAGAGGATCTGAGCGC
TTCCTCTTTACTCTCAGAGTTTCATCAGGACAAATACCCA
GAAGGAGGATAGAGGGACTGTAAACTGTCCGAACGGACCG
TGAGAAAACAGGAAGTGCTCCTGAGCGCAAGAGAAAGCGA
GATGAAATCTATTTACAGGGCTTTTTCTCTGGGGAAGACG
GAGCCATTGTTACACAGCGAGTTTGTGCAGCGATATCCTT
CCTATAGACGAGGAGACACTCAACTGCCAAAAAACGTATC
TGGTCATCGTTCGGACCAGCCCAAGACGTCCACCATACTG
CTGCCTGACCTTTGACCTCCACGACACAACAAACCGAAAG
TGTTTTCTCCGTACGTCTGTGTGCAGCACACGGTGCAGAC
GCAGCCGGCTGAGGTCGATCATTTCTGGCGTGAATCGGTG
AGGATGAGGAAATACAGGATGATGAGGAGGAAGAAGAGCC
AGATCTACACTTCTGCTGCTCGCGTCTTCTGAACGCTTGC
TCTCCGACGAGTCCATGATCACGATTTCTGGATCATCAGA
CTATCATCTCCATCAGCTGTGGAGGAGAACAACATGGAGA
GCA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-14c17.4-001 Contained in:

OTHER si:ch211-14c17.4-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000061730 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE321807 (1) 919 bp
    CITATIONS (1)