header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-2272
Transcript Name: ptger4a-201
Previous Name: ottdart00000061724

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061724 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061724|OTTDARG00000042722|ZDB-GENE-060222-1 ptger4a|OTTDARP00000048275 ptger4a-001 LG_ CT027631.14 Danio rerio protein_coding KNOWN, 1352 bp
AAAATGCCTGCTTAGCGCGATCTCCAGACTCCCAGCGCGT
CCAGCAGCAGCATGGAGCCCACCGTGCCCACCATCCCCGC
CATCATGTTCATCTTCGGGGTCATCAGTAACCTGATCGCC
ATCGTGGTGCTCTGCAAGTCCCGCAGAGAGCAGAAGGAGA
CCACCTTTTATACCCTGGTGTGCGGGCTGGCGGTCACGGA
TCTCCTGGGCACCGTGTTGGCCAGCCCGGTCACCATCGCC
ACCTATGTGAAGGGCGCGTGGCCGGACGGGGACCCGCTGT
GCCAATATTTCGGCTTCGTGCTGCTGTTTTTTTCGCTCGC
AGGATTGAGCATCATCTGCGCCATGTCCATCGAAAGATAC
ATCGCAATCAACCACGCGTATTTCTACAATGATTACGTGG
ATAAGCGGCTCGCGGGGGTCACCCTACTCGCCATTTACGC
ATCGAATATACTGTTCTGCGCGCTTCCAAGTGTCGGCTTC
GGCGAGGTGAAAATGCAGTATCCTCAAACCTGGTGCTTTA
TTGACTGGCGGACCAATGTGAGCGCGCACGCGGCGTTCTC
TTACATGTACGCGGGCTGCAGTTCTCTGCTCATCCTGGTC
ACGGTGGTCTGCAATGTGCTGGTGTGCGGCGCGCTCATCC
GCATGCACCGCCGCTTCGTCAGGCGCACGTCTCTAGGCAC
TGACCCACAGAGAGCCGCCGATCCCGGCAGGAGCCGCAGC
TTCAGCCGCCTGGCCGGCGCGGAGATCCAGATGGTCATCC
TGTTGATCGCCACCTCCGCAGTCGTGCTCATCTGCTCAAT
CCCGCTTGTTGTCCAGGTGTTTCTCAACCAGCTTTATAAG
ACTCCAGTGGAGAAGCGTCTGGATAAAAACCCAGATCTTC
TGGCCATCCGCTTCGCCTCCACCAACCCCATCCTGGACCC
GTGGATCTACATCTTACTGCGTAAAGCGGTCCTGTCCAAA
GTGGTGGAGAACATCAAGTGTTTGTTCTGCAGGAGCGACT
CTCGCGGCCAGCAAACCCAAAACAGCCTGCTGTGTATAAA
CGGCCAGCAGTTTTCCTCCAGAGACTCTCCGTCTGCTGTG
TCCCGCGAGCTCCAGGACGTCAGCAGCACCTCTCAGACTT
CATTAAACCTGGCGAAAGCTCCTGACGGCGGGCAGAACTC
CAGCAGTGAATCCTGTAGATGCAGCAGCCATGATGGTCAA
TGCAAAAAGCAGAGCTTACAGATGAGCATCACTAACGACA
GCGTCCAGGAGAAGAGCATCTGAGAGTAGCTTATATCACT
TTATTTATTGGAGAAAATCACACTGTAAATGAGCATTGCT
TTTGAGGAATTAAACTAACTACACTCCAGAAA

ptger4a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ptger4a-201 1352
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptger4a-201 Contained in:

OTHER ptger4a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000061724 (1)
  • Ensembl_Trans:ENSDART00000082296 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC127559 (1) 1370 bp
    GenBank:DQ202321 (1) 1362 bp
    CITATIONS (2)