Transcript

plekho2-201

ID
ZDB-TSCRIPT-141209-2248
Name
plekho2-201
Previous Names
  • plekho2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000061649 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000061649|OTTDARG00000042664|ZDB-GENE-120406-4 plekho2|OTTDARP00000048219 plekho2-001 LG_none CT030046.12,CU929410.12 Danio rerio protein_coding KNOWN, 9183 bp
GGCGAAAGTTTATCGACGGAATTCCTGGCGTTTCGAGGCT
GTCTAGATAGTCATCACACTGCGCTTTGAGACGCGGCCCT
GGTGTCTCTTTTTGGCAGAGGCAGAGGCTTTTGGGGACTT
ACCGGAAACCAAACTTTTTTTTTTTCAAGCCTCAAACTTG
TAGCTGCTGCAGAAGTCGAAAGAGGAAAAAGAGCAGCAGA
GTCCCGTTACATTTCAGCTCGTCGTACGCAGTTCCTTGTT
TTTTTCTCCTTCTTCTTCTTCATCGTCATGTTGAATGTGG
GAAAGTTGAGACGAAGAGCGATCAACAGTTTTAACCCGAG
ATAAAGTCCTGCGTCGAGCCTTTTTTCTCCTGCGCATAAC
GGGATCTTTGTTTTTATAACATGGAAGATGGTGTGAAAGA
GGAACCAGCCAAGCCCAAAGAGGTGAAGAGCGCAGAGAAG
GCCGGCTGGTTGAAGAAGTCTTCAGGGAAGTTCTTGAGCA
GCTACAAGGACAGATACATTCAGCTGGACCGAACCGCCAT
CGCCGTCTACGAGAATGAGGAATTAACAACATGCCTGGAG
AAACTGGAACTGGACAACTACGAGACGTGCCATGAGCTGA
AGAGTGCATTCAAGAAGAAACACAGGCTGGTACTAATACG
AAGCCCCAAGAGCGGTAACAAGGTTCAAGATGTCAAACTT
CAGGCACCGACTCCTGAGGAGAAGGAGGCCTGGATCAAGG
CGCTGTGTGAAGGAATTAATAAGGCAAAGAACAAAGTTTT
TGATGAGGTGAAAGTTGATGAAAGTAGTACTTTAGAGCAT
GTCACACGGGACCGGCCTAAAGGGAACCGTGGAAGAAGAC
CACCTACGAGGATACACATGAAGGAGGTTGCAAATGTTTC
CAATGATGGAATGTTGAGACTAGACCTTGATGGGGAGGTT
ACTATGCTCAATGGAACCCATACCTTGAATAAAGAAGGGG
ATAAACAGACTGAAACTTCTAAACCAGCCGTAACATTGAA
CAACATCCAGGAGGAGGACGCTGAAGAGGAACCCACACCC
CAGAAGAAAGTTAAGCCGCCCATGCCTCCATCAAAAGATA
ATAAACCCAGTGAAAGCATAAAAGAGGATGAGCCCAAAAA
CGAGGAGCCTGCACCACAGAAGAACATTGTTACGCCACCG
ATGCCTCCATCCAAGAAGTCCAAACCTAGCATCTCTCTGG
AGTCTGAAGCAGACAGCACCGACTCTTCTGAATCAACCCC
ATCCAACAAGGGCATCCAGCCTCCAGCTCCGCCTTCGAAA
CATATGAAACCCAACCAACAGGTAACACCAGCCACAGTCA
CAACAGACCAAAAAGAAACCCAAGAGAAAAACGAGGAGGT
TGACGATGATGCAGGTACTAAAGTCAATGGAGCTTCAAAG
GAGAAAGAGGACCAGGACAAACCAGAAGAAGTCGAAATCT
TGATTCTTTCCAAACAAGTCATGAAACCTCAAGTAGTGAT
GTGGGACTCACCCGTAGTTGTATCAAAAGATGCCGAAAAA
GAGGCGAAAAGCGCAAAGAAGGTCTCTGATATTACAAAAG
AAGTTACAACCACAACAGAACCACAGCAGTTGAATCCAGC
TCCAAGTTCAACACCTGAATCTGTTAAAAAGAGTCCCGGG
CCTCCTGCTCCACCCAAGAAGAAGCCAATTAAGGCACCAG
ACAAAAAGGAGGACACTCCCCACCAAGGTGACCAACCGGT
CCTTTCGGATTCTTCTAATGTGTCTTTGAAAAAGGTCTCG
GAGCAGTCTTTCAAAAAGGACGATCCCAAATTGACAATTC
CAGATCACAAAACTGAGCCAGTTGGTGATGTTTCAAGTGA
AGAAATGGAGGAGAAGTCTTTAGACAGTGGACAGCACTCA
GGAGAGGAGTCTGAGACCGGTGACCAAGTTACGCCATCCT
CCACAAAGCTCAAAGGAAGCTCCCAGGGATTAGATTTGGA
GACCAGCGAGGATGATCTAGAACCATCTGACAGCAAAGCC
GAGAGTTTGGAGGACCCATCGTTAGAAACTCCGTCCGTCA
CCCCAGAGACCTCAGTTCTCAGTGCACATCCAACCCCAAA
CCAATGCTCCAACAAGTCCATGTCCCGCACTTTGCCTCTC
AGTCCCTCCTCCAAGGGTCGTTCTGCATCCCTTGGAGACC
TTCTTTCTGAGAGCACCGAGAGAATGGAAAGCAAGGGAAA
ACCACAAGGAAGTGAGCTCAAGGTCTTGCAAAGCAAAGTG
TCTATTGAGATTGAAAAGACGGGAGAGCTGCTGAATGCAA
TCGCGACCGGACAGAGTGAAGACAAGGAGGAAGCAAGCCC
AGAGATGCTGCTAGCTGCAGCCATGGAGAAGCTTAGGAAA
GCCGATCAGTTCCTAAAGGAAGCCAGAAGCTTTAAAGATC
CAAAGGGCAGCAACAGATTAAGTTTGTAATGGTAAGTGTT
GGTGGACAGAACCTGTAGGGATGATCCATGCTGAAAATGC
AATACACAGTATGAAAATGATCAAATCAAGAACTTACCCC
TCTCCATTTTCTAATCCCAGAGCTACTTTTTAAACCTCGC
TAGGCCAGGTTAGCTAGCTAAAGTAGATGTGTAGCTTCAA
CAGTGTGTGCTAATGTAGCAGATGCATCAAGGGCATCTGA
TCCTGCTCCTGGATTTCCACTTTCCTTCACTTGCCTGCAA
GTCCAACAACGTTTTTCAGGTCTAAAAAGCTGGATTAGCT
GATCCACGATTGTTGTTGAAAGTTGTTCTACTTTCTACTT
TAAAATAACATTTGGAAAAGGGATACCCAACTTGGTCCTG
AAGGGCCAGTGTCCTGCAGAGATTAGTTCCAACCCCAATT
AGACACACTTCAACCAGCTTATTAAGCTAGTTCTAGATAT
ACAAGAAACTTTCATGTAGGAAGTTGAAGGAAGTTGTAGC
TAAGCTATGCAGGACACTGACCCTCCGCCGAGTTTGGACA
TCCCTGACCTACAATGTCGCTTGAAGTCTGACATCCAACC
TGTGAACTTGGGGCAGATCCAAGAACTCTGACCTCAGGAA
ATCTCTTAATTTGACGTCACTTTATAGATGGCGACTAGTT
CTATTTCAGTGAGATTGGCACAGAACATGTAAAAATAAAC
CCTTAAGTATTTTTATAGCACAAAAGATGTGCGGAACCCC
ACCAGTAAAGGCTATTTTTTAGATGATATCGCTTTTTAGT
ATTAAGGTCTGCGCAGGACTGTTATTTCATTCCCACTCCA
GCTGGGTTTTATTTCCGCTCCCTCTATTTATTCACTTTAA
GCTTCCCGCTGAGTCTATCGTCTGACCACTCAAACCTGTT
CAAATTAAACAGAAAAATTAACCCGCGCTCAATATGGTCT
GGAATGCAGACCTAAATTTTAGTGCATTTACTTTTTTTTA
AAGGACAACAAGCATTTTTGTTCTATTTGGTTTAGCCATA
TCAACATGACGTGTTATGAAATATTCACGTTTTATGTTCT
GAAAATACAACTGTGTGCACAATCGACTGGAAAGTCAGAA
GTTAGACATTTCACTAATGAAATTTCTACTTCCGACAATG
TGTCTGAAGCACAGCATGTCTTAATGTTGGGAGATGGGAA
GGTCCACTCCTCTGACCTGTAAAGTTGCTCAAGCGATAGA
AGTTAGGGGCCATGGTCTATGGCCTCCTTGTTAGAGCAAC
CCACTCCCATGCGGAAGGTCGCCAGATTGATACCAGCTTG
GAGCGGGTTGGGTGGTGTAGGACCGGTGGGGTTACATTGG
TGCCGTGACCCGGATGAGAGTGAGGTTTAGGGGAGTGAGT
GTAACAGAGGCCAGCTAATGAATTGCTGTGCAGGTAAACC
TCACTTCTCTGACCTCTAAGGTTGCTCTAGCGACAGACAC
TAGGGGCAATAGACTTTAGCGTCCTTGTTAGAGCAACCGA
CTCCCATGCGGAAAGTCGCCGGTTCAATACCAGCTCGGAG
CAGGTTGGGTGGCGTAGGACTGGCGGGGTTACATTATACT
ATTGTAAAAATTGTGATGACTAAATTGGATCATGTGAGGC
ACCTCGCAGCCAATCACATGGGGTCTGGTGTCCTTCCCTA
CATAACGCAAAAAAGTCAGTGTTAGCTTTAAGCCGCTGTC
ACACTGCACTTTTTCTCCCATAGAATTCCAATCATACGCA
TACAAATACCACAGATCGGAAACGCAAGCTTGTGCAGCAA
GTTTCGCAAATTTGCTGCTTTGCAAAGTTCCAGCTTGCTG
AACTCTGACTTGTGAAATCGCATCACGTGATTGCATGAGA
CTAATAGAAGATCAAAACATGACCTCTCTGGACAGAAATG
TAAAAAAAAAATTGACGAATCGCTCGCTTTTTAAGTATTT
AATCGTCTTGTTTAATCCTGCCTCTTTTAACAGCACCATA
CGACAGAATTTTGCACGCTCAAACTCTAGTGTGACCATGC
CTTTAGTGATTATGTTCTTGGCTAATGGCTGCAGGCTTGC
CTTGGTTCAGGTGTGTTTAATTAGAGTTAAACTATGCAGG
ACAGTGGCCCTCCAGGAACAAGATGATACTGCAAGTTGCT
GGTAGGATGATAAACTAGTTTCTCTCCTAACTAAGTAAAA
GAATAGCAAAAATTGTACGGGCTACATGTTCTGTTGTAGT
GAAACATGAAAATTGCTAGCCAATTAGCATTCCTTCTGCT
GTGTCGAGTACTGTGGTTTTAGCTTGTTTCAGTTGAACAG
TTACAATTTCTCTTTTATATCCCATATATTTTGATCTTTT
GATATTAGGCACTTTTGTTCGATTTGTTGTACACATAAAA
TGTGATTTCCTTTTAGGATCACAAACCCTCATTGATCACG
TGCACATAATCACTATTGGGAATTGTTAGCTTTTTATGCT
AACTGCACTGTAACTCCTATGTAAAAGGAGGAGTGGACAA
ATGTGTGAAATGTCAGTCATTAAGCTCTTTTGTTGCTAGC
AAGCAGTTAGTAAAAGGGAGAAATCAATTGGGAGAGATAT
GATAGTGGTTTTAAAAGTTGCATGTTTTGCTCATTTCTCG
TTTTAAAACTGCTTCAAGCAGTTGCAGGCTTTTTGCTAAC
TTAAACTAAGCTAATTCTGATCACTCATTCCCTTATTTCC
CGAACTCCACCCATTAAAACGGTCTCAGCCAATCCAAATG
TGCTAAGCCATACACTGAGAGAAAGGGTTTTGTTTGTTTG
GCTAGTTTTCCGATTGGCTGCTCTCCTGATACTGTTTACC
AAGCCAAGACAAAGAGACGAGTGTGTTTCTTGAGACCCCT
ATTTTCAGTGATAATAATACAATTATAGCACCTTAAAGTA
ACTTGTTTATAAAATGCCTTGTCAACTATCACAGTATAAA
TATATAGCACATGAATACCTAATAGAAAGTGCCAACTAGA
GTGTACAGGGATAGTTCGCCCAAAAATTAAATATTCTGTC
ATAGTTCACTTACTTTTTAAATGTTCCAGACCAGTTGAGT
TTCTTTCCTCTGATGAACACAAAATAAGATTTTTTGGAAG
AAAGCTAAAATCCTGTAACCATATCCTTTTCATGGTATTA
GTTTTTTTCTACTATGAATGAAAGTCAATGGTTACAGGTT
TTTTACTTTCTTTAAAAAATCTTCTTTTGTTTTTAGCAAC
TTAAGGCTGATGAATTAGTGATTAACTTTCGTTTTTGGGT
GAACTATTCCTTTAATCGCCTAAATGAAAGCCACTCAGTT
CTGAATCATTCATAGTTTTTTTTTATTATTGAATTTTGAT
TACATTTATAAAATGAAACATCCCAGCAGGCACAGGATGT
CAACATGATGTCTGATTGACGTTGTACCCCAACATTGTGG
GGATGTTGCATTTTGTTTGGAAATATAAATCAGATTGACG
TGAGAATCCAACCTCAATGTCCAACCTAAAACCAACATCT
AATGATATTACAGCTTGACATTGTGTTGACGTTACCACTA
TGACATCTATCAGATATTTGATTTTGGTTGCCATACCTGA
CGAATAAATGTCTGTATTTGACGTCAATATGACGTTAGTT
TAAGATGTTGGCTCGACGTTGGATTTTGCTCACTTCTAAC
ACAACCTTAAATCAACCAAATATCAACATCTAATGATGTT
ACAGCTTGATGTTGTGTGGACGTTACCACTTTGATGTCTA
TCAGACATTGCATTTTGGTTGCCATACCTGAAGAAATAAA
TGTAAACATCATTTTGACGTTTAAGATATTGGCCCGAAGT
AAGATTTTAGTCACTTTCCAACACAACCTAAAATCAACCA
AATATCAACGTCTAATGATGTTACAGCTTGACGTTGTGTG
GACGAAACCACTATAACGTCTATCAGATGTTGGATTTTGG
TTGCCATACCTGACGAATAAAGGTCAGTATTTGACGTAAA
TATGATGTTAGTTTAAGATGTTGGCTAGATATTGGGTTTT
AGTAACTTTCCAACACAACCTAAAATCAACCAAATATCAA
CGTCTAATAATGTTACAGCTTGACGTTGTGTGGACGTTAC
CACTATGACGTCTATCAGACATTGGATTTTGGTTGCCATA
CCTGAAGAAATAAATGTAAACGTCATTTTGACGTTGGTTT
ATGATATTGGCCCGAAGTAAGATTTTAGTCACTTTCCAAC
ACAACCTAAAATCATCCAAATATCAACGTCTAATGATGTT
ACAGCTTGACGTTGTGTGGACGTTACCACTATGACGTCTA
TCAGACATTGGATTTTGGTTGCCATACCTGAAGAAATAAA
TGTAAACGTCATTTTGACGTTGGTTTATGATATTGGCCCG
AAGTAAGATTTTAGTCACTTTCCAACACAACCTAAAATCA
ACCAAATATCAACATCTAATGATGTTACAGCTTGACGTTG
TGTGGATGTTACCACTTTGATGTCTATCAGACATTGGATT
TTGGTTGCCATACCCGAAGAAATAAATGTAAACATCATTT
TGACGTTTAAGATATTGGCCCGAAGTAAAATTTTAGTCAC
TTTCCAACACAACCTAAAATCAACCAAATATCAACGTCTA
ATGATGTTACAGCTTGACGTTGTGTGGACGAAACCACTAT
GACGTCTATCAGATGTTGGATTTTGGTTGCCATACCTGAC
GAATAAAGGTCAGTATTTGACGTAAATATGATGTTAGTTT
AAGATGTTGGCTAGATATTGGGTTTGAGTCACTTTCCAAC
ACAACCTAAAATCAACCAAATATCAACGTCTAATAATGTT
ACAGCTTGACGTTGTGTGGACGTTACCACTATGACGTCTA
TCAGACATTGGATTTTGGTTGCCATACCTGAAGAAATAAA
TGTAAACGTCATTTTGACGTTGGTTTATGATATTGGCCCG
AAGTAAGATTTTAGTCACTTTCCAACACAACCTAAAATCA
ACCAAATATCAACATCTAATGATGTTACAGCTTGACGTTG
TGTGGACGAAACCACTATGACGTCTATCAGATGTTGGATT
TTGGTTGCCATACCTGAAGAAATAACGAAAAATTTTGATG
TTTGTTTAAGATATTGGCCCGAAGTAAGATTTTAGTCACT
TTAGTCTGACATTGGATTTTGTTTGCCAGACCTGACGAAT
ATATGCTGGTATTTGATGTCAATATGACATTAGTTTAAGA
TGTTGGCTCAACGTAAAATTTTGGTCACTTTCCAACCTAA
AATCAACCAAACATCAATGTCATTTGACATCGTTATTAGC
ATCAAAATAATGTTGTCCTTAGACACTGAATTTTGGTCAC
CTGACGTCATGCCCTAAATCTAACCTAGTATTAACGTTTT
ATGATGTTGTGTGCCTGCTGGGATTATCACTCTGTCATAA
ACTACCTAATCTTAAATAATATCCTCAAATCTACGTGAAA
TATTCAAGATTAAACTACTGTTTAAAAGCATGGGGTTGTG
TACGATGTTTTTAATGCTTATTTTTATTTATTTATTTGTT
TTTTTGGCAGGGACAGTGTACATTAATTAGCATTTTCTGC
CAATGCACCAGAATTAGCCCGAAGGCTGTTTTTCATCTGA
ACAACCTAAAAAAAAAACAATACAAGAATTATACTGAAAG
AATGAAAGAATTCTCACCATAGCAAAAACACAGTAGAATC
TGCAATAATCCTATATTTCAATGTTTAAAATAACTTCTAA
GTTTTAGAAATGATTTAATTCCTGAAACTGATATTAAATG
ATGTGATCAAAAATGCTTATTATTTGAGGACAAACAAAAT
ATAAATGTTTTTGCAGCTTTATAAATGTAGTTTGATCAAT
GTAACATGTCTTTGTTGGATAAAAGCATTTGTTTATATTA
AATTAAACCTTTCAAACCCCGTATTTTCAACAGTAGTGTA
GTGTATTCAATTAAATTGACTTTTTTTATGTTTTGAAGGT
GCTCGACTGCGAAAAGGCACACACTCGTGCAAACACTGTT
AGTTTAAAAAAAAAAAGTCTGTTCCTCAATCTTTGTCTTA
CTGAAGTAGTTCCTTCTTCAGTCTATTAATAATCTGCAGA
TACAACTTCCTGCTGCCTACATTATCAGCCTTAGTTTCTT
TTACGCACACAGATCTAGTTAGCAGGCCATTTATAAATCA
TGAGGAAGTGGTTACAGACTATGTGGAAAAATCAACTTAG
TCGATAACAACCTCAAGTTGGTTTTACTTAAAAGTTTTGT
GAATACTCCCACGTTAAGAAGTGTTTTGCGGTACCGATTG
TGTAATATATGAACTTACTTGTAAATAGTGCTTGATATAA
AGTATAATGAGACTCGTTTTTAGTTGTCTGTCCATTGCGC
ACTCATTTCTCTAGCGTTTCATTCGCTAATTTCCCTTTCT
TTTTGTATCATTTAATGCTAACTGTAGCTTATTTGAACAT
TATGTTGTAAATAACATGGCCACCATTGAAATGCTTAATA
TTTAAGTTATTAATGTTCTGATATATTCGTGTTTGATGTC
TGTCTGAAACAAAGCTTAAGAACAAATTTAAAACGACTGT
TTACTTTGAATTGTTTACTGTTGAAGAGGCTGGTGGATTT
ATTGTCTCGCAGTACGTGTTAATTGCATTTACTAACTGGA
CTAATTTTATGTTTCGTTTTAATCGAAATGCATATTAAAT
GTGCAACAAAAATGGGAAATAATTGCTTTGCAAAGCATGT
TTTAATAAAGACAAAATGTCTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations