Transcript

abhd8b-201

ID
ZDB-TSCRIPT-141209-1835
Name
abhd8b-201
Previous Names
  • abhd8b-001
  • dkey-67m7.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060225 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060225|OTTDARG00000041789|ZDB-GENE-130530-805 abhd8b|OTTDARP00000046539 DKEY-67M7.5-001 LG_ BX255969.8 Danio rerio protein_coding NOVEL, 2403 bp
TCTACGCTGATCATTTAGAAACCAAGGAACCCAAATGGAA
GAGAAATAATCGCTTTAATGATCATAGGAAGGTTTTTTTT
TGGCTTAAACAAACATGGTGTGGTATAAAGATGTGTATAA
AGGAAGACTTGCAGTCTGTTAAACAGTTGAAATGTGAAGA
TATCCAAAATCCAACGTCCAGCATCAAGGGAAGGCAGCAT
TGCTGAACACTCTGAGGTACATTTTTGGCAGGAGGAACTG
AGTAACCCAGCACATGGTAAATTAAATTAATGGATTAATT
TCAATGTGTTTACAGATCCTGGATCAGCCAAACTATGGTG
TGCCAGTCCAAATAAGCAGAAAAGCAAGTACTAAACTGTT
TTAAGAACCAGCAATGTTTCTTGTTTCCCCAGGTGTTCAC
CATGCTCACCAGCTTTGTGGACGGAATATTCTGCTGCTTT
ACAGGGAAGTCTACCAACGTGGTTGTCCCTGTCGAGTCCT
CTGAGCCCACAGATGGTTTTGAATTTGTTGAAGTAAAGCC
AGGACGAGTTTTGAGAGTTCGACACATCATCCCAGACCGA
CCTGTGGTTGAGGAGCCAGGGACTGGGGAAGGCGGTACAG
TGAGCTGCAAGCGTAAAATCTCAGTGTACAGAAACGGACA
GCTTCTTATTGAGAATGTCAACGAAGCCACGCACCCAGAG
CTGGTGCGCTATCAGAATGGAGACAGCACTGTGGATATGG
AGGTCTCCAACTGTGAGTCTCCTGTGGTAGGCCAGGCTAC
TGAGACCCCAGCAGGAGGACAGGCTGCAGAAACCAAACCT
GCCCCACAGGAACAGCAGCAGGTGCACCGTAGGCGCCGAA
AACCCAAACGCTCAATCGTGATCGACTGTGAGCGGAAGAT
TACTTGCTGCAAAGGTACTCATCCCGACGTGGCTTTGTTT
TTCATACACGGCGTTGGGGGATCACTGGATATCTGGAGAA
GCCAGCTGGACTTTTTCTCCCAACTTGGATATGAAGTCAT
CGCCATGGACCTGGCCGGCCACGGTGCAAGCTCAGCCCCT
CGCATTCCTGCTGCCTATACCTTTTATGCTCTGGCTGAGG
ACGTCAGAATCATATTCAAGCGATATGCGAAGCGGAGGAA
TATTTTAGTTGGACACTCATATGGAGTCTCATTTTGCACC
TTCCTGGCTCATGAATATCCAGAACAGGTTCATAAACTTG
TGATGATAAATGGCGGCGGGCCCACAGCACTCGAGCCCAG
TCTCTGCTCTGTCTTCAACTTGCCCACATGTGTCCTTAAT
TTTCTGTCCCCGTGCCTCACCTGGAGCTTCCTCATGGCTG
GGTTTGCCCATCAGGGAACAAGGGAAAAGAAATTACTGAA
AGAGAACAATGCCTTCAACGTGTCTTCCTTCGTTCTGAGG
TCCATGATGAGTGGACAGTACTGGCCGGAGGGTGACGAGG
TTTACCATGCTGAAATCACAGTGCCTGTTCTGCTGGTTCA
CGGCATGTATGACAAGTTTGTACCAGTTCAAGAGGACCAG
CGCATGGCAGAGATCCTCTTGCTGGGTTTCCTGAAGGTTC
TGGATGACGGAAGCCACATGGTCATGATGGAGTGTCCTGA
TGTAGTCAACACTCTGTTACACGAGTTCTTCTTGTGGCAG
CCAGCAACCGCCTCAAAGCCCAAACAGGAAGCAGCGCCGA
CAAAGACCAACACCAAATCTCCAGAAGACACATCCAGACC
TAAAACTGCCCCGAAATCACCCTCCAAATCTCAACCTGAT
TTGCTAAGACCGACAACTGCACCTAAAACAACCAACATCG
CCACAGAAGCCCCGGCAGTAGCGGACATCAAATCTAAGGG
CAAGAAATAACTGCTTTTCCCAATATACATGTGCTGGGGT
AAAGCATTGGGCTCGTGTGATAGAACAAGTTTAATGGAGC
TTTCTGAACATTGGATATCACTGGATATTCACCAGCTGGT
TTAAAACAGTTGGTCTAAAAGCACGAGGGTCTACTTTAAT
AATTCCAGTTTTGGAGCAGGATGATTCCTAGAGGTTGTCT
TCTTTTCTGTGACACAGTCCTTTCCAAGTGATTTTTATTT
CTACCATGGGATATTATATATACTTGTATGCCATATGATG
TCAATTTTAAGGCTGAAAATGTCACATTACATAAGGGATG
AATATAAGCACTGCTGCCGCTGTTGAATCTAATAGACTAA
TATTTTGTATTTATTTATGCCAGTTTTTTTTTTTATTTGA
CTACATCAGCTGATGTCCATCAGTTCATACATGGGTCTTC
CTCTCTGTTAAAGTTTTATTTGAAACGTTCATTAGTGAAG
TGTTTTTACGTTCAGATGACTCCAGCACTGTTGCTGAAAT
ACTGTCAGATACGGTGACTTTACAATAAAAGCCATCAACT
TGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations