Transcript

nol11-202

ID
ZDB-TSCRIPT-141209-1682
Name
nol11-202
Previous Names
  • nol11-001
  • ch211-157f15.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054552 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054552|OTTDARG00000038084|ZDB-GENE-030131-419 nol11|OTTDARP00000042848 CH211-157F15.4-001 LG_ CR450715.13 Danio rerio protein_coding NOVEL, 2105 bp
ATGTAACGTAGAGACTCGAGTGCCGTACTACGAAGAAGAA
GTAATTGTCTCATCTCGCGATAGAAACAACTCGAGGGTAG
AAGAAACATGGCAACGCTGTATGAGGAATACACGCTGTGT
GGAGTTGGACCAGACAAGAATTCGTCCAGTTCAGGAGTTC
TGGGGATTGAATTGGGAAAAGATGTTGACCACATAATTGT
CACTCACTCTTCGAGAGCAGTTACAGTTTACAAGGTGTCT
GATCAGAAGCCCACGGGCAGTTGGACAGTGAAACAGGGAC
AGTTGATCACCTGCCCCGCTGTGTATAACACAAAGTCCCA
GGAATATGTGGTTGTTACAGATAATAAGGTTATCAGAGTT
TGGAAAGAAGACGATGTCAATATGGAGAAGGCGTTTAAAG
CCACGGTTTCATCTGATGTTCTCAGGGTGATGGCAGCTTC
TGACTCTGAACCTGTTGTGTTGTTTAGTTGTGGGGCTGTC
ATGTTCTTGGACTCGTTGCTTGCTTCACCACAACAACCTA
TAGAAGGCGTTTTAACAGAGGAAGAGTTCATCAGGTGGAG
TACTGTTGTTGGGGCAGAACACCAGCTTGTTTTGTTGTTT
TGCACGGAAAAGAGAGGAGAGCACTACCTGTATGCTCAAA
GATTTAACCCCAACACTGTTGTGAAGCACAGATTTGAGAC
TGAACCTGGTCCCTTCGCTCCTATCAGTTTCTCTGCCACA
TGCAGAGGTAGTAATATACATCTGCAGTACTTGTATATGA
GTGGCAGAATATATGAAAGTGTTTTACCACTCAGAAGTTC
AGTTTCTGAAGCTGAAGGTGTCCAGGCTCTACCCCGCTCT
TTGTGTCTCAGTTTACCTCTGGGGGAGCAAAAGCTGACGT
CTGGTGCTGCTATTGTACTTGATGAGGCTCATGTTGCTAT
TGTTGGATTTCCCCACCCGTCTGCTGGAGCTGGCAAAGAT
TATCTTTGCATCTGGAACAAACATTTCCAAACTCTTCAGG
CTTGTAAAGAATTGGCCGGAACAATCTACAGTCAGATCTG
GTGTTATTCTGGAAAGCTGTACATTCCTCATGGGAAGATA
CTATCAGTAATTTCTTTTGAGTGCCAAAAGTCATCTCTCG
CGGCTGCCATGGGAAAACTGAAGCAGACAAATCAAAGTGA
ATACAAATCACACACCCCCTTGTCTTCCTGGACGGCTTTG
CCGCACAATGACATTATAAATGCAGCAAAAGTCAAGAGCA
GAATGTCAACCAGAAATGCTTCAAACGTCAAGTCTCCACT
GACAGTAGATCAACTTATAGACCACATTAAGACTGCTGTG
GTAGAGGATGTGCAGTCAGCGGTGGGTGAATTTATTCATC
AGACTCCTCAGACTGACCTTCAGCTTGCAGCAGGGAAAGT
GACAATGGTGCTAGTGTCAAGATCCCAGACAGATGACAGC
TTCTACCCTCAGCGTGCATTTCTACAACTGCTAGACACTC
GTTATCTCTGCTACAGTGTTTGCCCAGAATTGTTGTCTCT
GGCCATGGCAAAGAGAGATTTTCAACTCTGTCAGATTGCT
TTCCAACTTTTTCCAGACATTCCTGAAGCTGTTACCTGTG
CTTATCTCAAAACCATTTTGAGTACTCCAGACTCTGAGAT
GGAGACTCTAACCCTTGACACAGAGAGCTTAATCATCATG
AAAGAAATGAGTCAAGCTCAAAGTCAAATGGAGGAAGGTG
AGCAGCAGAACGAGAACGGTGTCTCTAGCAGCAAACAACA
GAGGGATTTCTTGTCCATGGATATGAAGTGTCCTGTGGGA
TTACACAAGGGTGTCCTTCTAAATGATGTTTTGCAGACCG
CATACAGTGACAAGCCTCTGCTGCAACATCTAAAAGATCT
CACAGTTTTGCAGGTCATGGTCTTTTTACAGTACCTGCAT
TTCCTTTATCTTAAATATTCTCAAGATGTCCACAAACAAA
TCAGAGCTCTGCGCATCCCAAGTATTTCTCAGGTCATTGA
CTGGGCGTCCCTGATACTTGATGCTCATTTCACAGTTTTG
GCTGTGGCACCAGAAGCCAAAAGTTTAGTGTCTGATCTTC
ATAAGTTCACAAGATCACAGGTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations