header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-1396
Transcript Name: selenot1a-201
Previous Name: selt1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039731 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039731|OTTDARG00000029003|ZDB-GENE-030327-6 selt1a|OTTDARP00000031768 selt1a-001 LG_ CU633992.6 Danio rerio protein_coding KNOWN, 1301 bp
GACTGATCATGGGGAAGATGCGCTGGCTGCCGTTCTCGGC
TCTACTATTATGGGCCTTATGTCTTCACAGCGCTTCTGCC
GATAACAATGGCGTGAAGAAAATGAAGATGCAGTTTGCCA
CGGGTCCACTTCTCAAATTCCAGATTTGTGTCTCCTGAGG
GTACAAGCGGGTGTTTGAGGAGTACACGCAGGCTTTGTAC
CAGCGGTACCCAGACATCCGCATAGAGGGAGAGAACTACC
TTCCTCTGCCCCTCTACAGGCACATTGCTTCCTTTCTGTC
AATGTTTAAGCTGTTGTTAATCGGAGTGATCATCTTGGGC
AAGGATCCTTTTGCTTTATGTGGCATGCAGGCTCCAGGGA
TCTGGGTTTGGAGTCAGGAGAATAAGATATATGCTTGTAT
GATGGTGTTCTTCTTCAGCAATATGATCGAAAATCAGTGC
ATGTCTACAGGCGCATTTGAAATCACGCTCAATGATGTCC
CAGTTTGGTCCAAGCTGGAGTCAGGACACCTGCCTTCAAT
GCAGCAGCTAGTCCAAATCCTGGAGAATGAGATGAAGATG
AGCATGCACATGGACACACTTCCACCCCATCAGTCATAAC
CTTGCCTCTGATTCACTGAACTGAGCCTATGACCCCCTCC
ACATTTCTGGTGGCGCTCTCCTACGGTTGTGAGATGGCAT
TTATGAAGGTTTGTGCTGAAAGTAGCAACTACTAGCACAC
ACCGGATGTTCTGCGCTCTCCTCATCGTGCCCTTTGGAGA
TGCAGCACCTACAGCTGGTGCGGGATCTACGGCAACAACA
GTGCTCAAATAAACTGCAACCCCCATCCTCTGTGCAAAAA
CCATTTGCTTCAGGATAAATGTTCGCAAGCATCACGTCAT
AAATTATTTCTATTACATCAGCAAAAAAAATCTAACATTT
TAAAGTGATTTTGTTTCTTAATCATCCGTATGTCTAAACC
AGGTGTTTCTTTTATTTAATACATGTAGAAGTTTCTAATT
TATTCATCCAGCTCCATCAAAGTAATATTAATTCTATTTC
TGAGCCCTGATTTTTATATTGCTTTGTATAACTTAATGTT
TACTATAAGATGAATAAAATAGTCTAACAAACTAAACTAC
TCCTGGTCTTTACTGGAGAAATCGGGATGCAAATAAAACT
AAAAACGTTGAAATAACTTTAGCATTGGCAAAACTGAACA
AGTTTGTTTTGTCAATCGTTTACTCAATGCCTTCAAATGT
TTTAATACAGAATTGGGTTTAGGCTGCAATTTACTCTAAT
AAAGTTGATTATGTTGTTGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
selenot1a-201 Contained in:
[Fosmid] CH1073-20K7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000039731 (1),  Ensembl_Trans:ENSDART00000165712 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC054578 (1) 1357 bp
GenBank:AY221264 (1) 961 bp
GenBank:DQ660904 (1) 540 bp
CITATIONS (2)