Transcript

si:dkey-31e10.1-201

ID
ZDB-TSCRIPT-141209-1220
Name
si:dkey-31e10.1-201
Previous Names
  • dkey-31e10.1-001
  • si:dkey-31e10.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009178 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009178|OTTDARG00000032748|ZDB-GENE-060503-356 si:dkey-31e10.1|OTTDARP00000007909 DKEY-31E10.1-001 LG_ AL953910.14 Danio rerio protein_coding NOVEL, 777 bp
ACATGCTGCATCTTCTAATCGCTTTAGCTTTGCTCAGAGG
AGCTTATCCTTTGGAAATTGTGGCACGAGGAGTAACGGCT
GTTGTGTTTGGTCAGGATGCTTCTCTCTCTTGTATCCTGC
CGTTCGCGTCCGGCGTCAAACAGGTGACATGGCAGCGGGT
GCGCGCGCAGGATGTACACACTCTGGCCACGTTCAGCGAG
CGCTTCAAGGATAATGTGGACGAGGACTTTGTCGGAAAAA
TCACTTTCCAAGCATCATTTAATTCAACAACTATTGAGAT
AAAAAACACAACATTTGAAGATGAGGCTTGCTACATTTGT
TCCTTTAAGTATCCAACTGGACCCAAACGAGAAACCTTGT
GCGTCACTGTTAAAGGTATCTCAGAAATAACAGCGGCAGT
GAATCCTGCAGACACTTCTGACACAGAAGTTGTGGTTTCA
TGTTCAGCCACTGGTAAACCAGCTCCAACAATCCAGTGGA
AATCCAGAGAACAAGAGCTGAAGCACTTCAGGTCAGATGA
TTTCACAACCTACAACAAAGACAGCTCAACCACTGTTACA
AGCAACATATTACTTCTGCTATCCCAGTTTCATGGCAAGT
ACGTGGAGTGTTTGGCTCAGAGTGATGAGATTGAGAGGAG
CGAAACAATTTATTTACCTCGACAACAACATCCTGATGAA
GATGCATCAAGAAATTACATCATCACATTTTCGGTCCTTG
CTGTCATTGCTGTTGTGGTTATTCTCATTACTGTCGTCTT
TATTTACTGCAAACGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations