header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-141209-1049
Transcript Name: znf366-201
Previous Name: ottdart00000061726

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061726 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061726|OTTDARG00000042724|ZDB-GENE-110408-46 znf366|OTTDARP00000048277 znf366-001 LG_ CT027631.14 Danio rerio protein_coding KNOWN, 2287 bp
GTTCCTGTTCTCTTTCTTAAGTCACTTCAAATGCGGAGTG
TGAAGCTGGAGGCGCGTAGAGAGAGGAGAGACGAGCAGGA
GACGACAGCTGATGGAGATGATAGTCTGATGATCCAGAAA
TCGTGATCATGGACTCGTCGGAGAGCAAGCGTTCAGAAGA
CGCGAGCAGCAGAAGTGTAGATCTGGCTCTTCTTCCTCCT
CATCATCCTGTATTTCCTCATCCTCACCGATTCACGCCAG
AAATGATCGACCTCAGCCGGCTGCGTCTGCACCGTGTGCT
GCACACTGTCAAAAATGGACGGGATTTCAATGTGCAGGTG
AAGCAGGAGCTGCCGCTGTGGCCTCCATCTCCACTCCTCC
TCCGCTCTCCAGCTCCATACTTCCCTCCATTCCACCCCAG
CCTCGTCCCGTTCCCGTTCCTGCTTCCCGGCTCCGTCCCA
AATCTCTCCCCGAACCCTTTCTACCCCAGCGAGCCTTTCC
GTGTGCACCGCAGGCCTCCGGACGGGCCTGAGAAGCTGAA
CGTGCATGTAGACGACAGCTACTATGTGGATGTGGGAGGA
GATCAGAAACGCTGGAAGTGTCGGATGTGCGAGAAATCCT
ACACCTCTAAATACAACCTGATCACGCATATATTGGGCCA
CAGCGGGATCAAACCGCACGCCTGCAGTCTGTGCGGGAAA
CTCTTCAAGCAGCTGAGCCACCTGCACACGCACATGCTCA
CACACCAGGGAACCAGACCGCATAAGTGCCAGGTGTGCCA
CAAGGCCTTCACGCAGACCAGTCACCTGAAGAGGCACATG
ATGCAGCACAGCGATGTGAAGCCGTACAGCTGCAGTGTGT
GTGGACGGGGTTTCGCGTATCCCAGCGAGCTGCGAGCGCA
CGAGCTCAAACACGAGCGCGGACAGGAGAACGTGTGTGTG
GAGTGCGGACTGGACTTCCCCACGCTGGCGCAGCTGAAGC
GGCATCTGACGGCGCACCGCGGGCCCGTGCAGTATGCCTG
CAGCGAGTGCGGGAAGAGCTTCCAGTACCCGAGTCAGCTG
CAGAACCACATGATGAAGCACAAGGACATCCGGCCGTTCA
TCTGCAGCGAGTGCGGGATGGAGTTCGTGCAGTCGCACCA
TCTCAAACAACACACACTGACGCACAAGGGAGTGAAGGAG
CACAAGTGTCGCATCTGTGGCCGTGAGTTCACACTGCTGG
CCAACATGAAGCGCCACGTTCTGATCCACACCAACATCCG
CGCGTATCAGTGTGAGCTGTGCTACAAGAGCTTCGTGCAG
AAACAGACGCTCAAGGCTCACATGATCGTCCACTCCGACA
TCAAACCCTACAAATGCAAGCTGTGTGGAAAGGAGTTTAA
CAGAATGCATAATCTGATGGGCCACATGCACTTGCATTCT
GACAGCAAACCCTTCAAATGCCTTTACTGCGCCAGCAAGT
TCACGCTGAAGGGGAACCTGACGCGCCACATGAAGATCAA
GCACGGCATCATGGACCAGGGCCTGGATGCTCGCGTGTGC
AGACGCCAGGGTCGGTTGTGTCTCTCGGGCCCCCTGCGGA
TCCTGTCCCGCATCGGTCAGGACGAACCCTTCGATCTGTC
CCAGAAAAACCCACTGCGTCTTTCTCAATCTGACGGCGAG
AGCGTCCGCGGCGGCAGCTCCAGTCGAGAGGAGGACGAGG
ACAGCGTCTACAGAATGAGCCAATACAGTCCTGACAGAGA
AAACCCTGCGGAGGCCCGAGACCAGGAGGACGAAAAGAAG
ACATCACACCTCGCACAGATACACAGCGACAAGGAGGAGG
ATTTCTGAGCAGGACGACTTTGAGTTGTTGTCTTGTTTCT
ACTCCAGATATCTAAAAATTCTTAAATCAGGAAGCATTTT
CTAGATATATATCAGATAACACTTTATTTTAAGTAACAAT
TCACACCATTCATTTACTTCTGATTTATATCCTGCCTAAT
ATTAAGATATTAAACATTTATTAGCACTTATAAAGTATGA
TCTTATTCTAAATCCTTAATACTACACTGTAAAACGTAAA
AAGTTAAGGTAACTCAAACCATTCAAGTTCAAAAACTAAT
CCCAATGAGTACTGTGAACTTAATCCATTTGAGTAAATGA
AGCAATTTGAGCACAGTAAAGCCCAATGAGGCGAGGCAGT
GGCGCAGTAGGTAGTGCTGCCGCCTCACAGCAAGAAGGTC
GCTGGGTCGCTGGTTCAAACCTCGGCTCAGTTGGCGTTTC
TGTGTGGAGTTTGCATGTTCTCCCTGCCTTCGCGTGGGTT
TTCTCCG

znf366 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA znf366-201 2287
 Withdrawn Transcriptsextinct
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf366-201 Contained in:

OTHER znf366-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000061726 (1)
  • Ensembl_Trans:ENSDART00000149612 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK030074 (1) 817 bp
    GenBank:CR931165 (1) 539 bp
    CITATIONS (2)