ZFIN ID: ZDB-TSCRIPT-141209-1047
Transcript Name: parvab-201
Previous Name: ottdart00000061720

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000061720 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000061720|OTTDARG00000042718|ZDB-GENE-070424-60 parvab|OTTDARP00000048271 parvab-001 LG_ CR318640.10 Danio rerio protein_coding KNOWN, 2024 bp
AGGGAAGCAAGAGCCAGTCATCACTGAAATGTTTGGAATT
CCACTTCCGTTTAGCAGAATTCAAGAACTCCCCACGACTT
AAAGTCCGCTATTTACACTGCACGTCTGAATTAAAGCCGC
TGTTTTTCAGATCAAATGGCTTCTTCACCGCAGAAAATAC
CATCCTCCCCGAAATCGCCTTCCTCCAGGAAAAAAGATGA
CTCCTTTCTGGGAAAACTTGGAGGAACTTTGGCAAGAAGA
AAAAAGGCGAAAGAAGTGTCTGAGCTTCAGGAGGAGGGTA
TGAATGCGATCAACCTGCCTCTGAGTCCCACACCCTTTGA
GCTGGACCCTGAAGACACCATGCTTGATGAGAATGAAGTC
CGAACCATGGTTGATCCCCACTCAAGGAATGATCCCAAAC
TACAAGAGCTAATGAAGGTGCTCATTGACTGGATCAATGA
TGTATTGGTGGGAGAAAGAATCATCGTAAAGGATCTGGCT
GAAGACCTCTATGATGGGCAGGTTCTTCAAAAGCTCTTCG
AGAAACTGGAGGGAGAGAAGCTGAACGTGGCTGAGGTGAC
TCAGTGTGAGATCGCTCAGAAACAGAAGCTGCAGACTGTT
CTGGAGAAGATCAATGACACTCTCAAAGTTTCCTCCAGGA
ACATTAGATGGAATGTTGAATCTGTTCATGCTAAGAATAT
TGTGGCCATTCTTCACCTGCTGGTGGCTATTTCTCAGCAT
TTCCGGGCCCCTATCAGACTCCCCGAACATGTGTCCATCC
AAGTGGTTGTGGTCCAGAAACGAGAGGGAATACTTCAGTC
TCGGCAGATACAGGAGGAAATTACAGGCAACTTTGAGGCA
CTGTCTGGAAGATATGAGCGAGACGCCTTTGACACTCTCT
TTGACCACGCGCCAGATAAACTGAATGTGGTGAAAAAGAC
TCTAATAACATTCGTGAACAAGCACTTGAACAAGTTAAAT
TTGGAAGTGTCGGAGCTGGAAACTCAGTTTGCTGATGGTG
TGTACTTAGTCCTGCTGATGGGGCTCCTGGAAGGATACTT
CGTGCCCCTCTATAACTTCTTCCTCATCCCTGAACATTTT
GATCACAAGGTCCATAATGTTGCTTTTTCTTTTGAACTGA
TGCAAGATGGTGACTTGGAGAAGCCAAAGCCCAGACCAGA
AGACATTGTCAACTGCGACCTCAAGTCTACACTGAGGGTC
CTCTACAATCTCTTCACCAAGTACAGGAATGTGGAGTGAC
AGAGAAGCTCCAACATGCAAAAATGGCTCGATTTATTCAA
CCAAAATGCCCAGCGCATAGTCACAGCTGTATCAGTATTA
TTAGTATTTGTCTGTTGAATTCTTTTCTGTATTTTTTTGA
AGTTTGAAATTGAGCCTAAACAGTAGGTATATTTATTCAG
TTCACATGATTTTTTTTTTTTTATAAAATTCTGATTTGTT
TAATTGTTATTTTAGAAAAGAATGTACTTGGAAATATAGG
AAACTTAGACATACAGTTGGAGTCATTGAATTTTTATCCC
CCTGTATTTGTTTTCCCTCAATTTCTGTTTAATGGAGAGT
AAACTATGATTTTTTCAACACATTTCTAAACATCATAGTT
TTAATAACTCATTTTTAATAACTTATTTATTTTTATCTTT
GCCATGATGACAGTACAAAATATTTTACTAGATGTTTTTT
TCCAAGATGCCTGTATTCAACTTAAAAAGGCACCTATTTT
ACCCCCTTTACCCCTAAGGCACGATAAGCCTTTGGTGTTT
CCAGAATCTTTCTGTAAAATTTCAACTCAAAATTCCTATC
AGATTGTTTAGCTTCCAGCTTCCTTTTTTGTTGTCTGAGT
TTTGTTGTCTGAGTAAATTGTAGCTGTTTTTGTAGCCTGT
GACTGCCCTGCAAATGTAAATGTGACTGCAGTGCAAATGT
AAATGAGCTGCCACTTGTGTGCCTGCTTTTCAAGCTTTAT
GTGAGATAAACAGCAGTCAGTGATAGACAGAAATAGAGCT
TATTAGTAAAGAAAAAACAAGTAC

parvab TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA parvab-201 2024
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
parvab-201 Contained in:
[BAC] CH211-243M5 (1)

Genome Resources: Vega_Trans:OTTDART00000061720 (1),  Ensembl_Trans:ENSDART00000169182 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC134924 (1) 2007 nt
GenBank:DT873770 (1) 697 nt
GenBank:EB918078 (1) 547 nt
CITATIONS (2)