Transcript

ambra1b-202

ID
ZDB-TSCRIPT-131113-938
Name
ambra1b-202
Previous Names
  • ambra1b-001
  • ch73-151m17.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056353 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056353|OTTDARG00000039258|ZDB-GENE-050208-235 ambra1b|OTTDARP00000044191 CH73-151M17.4-001 LG_ CU181898.11 Danio rerio protein_coding PUTATIVE, 8596 bp
GAAATCCATTCAGCATTCGATTAACAGACCTAAAGTAGCT
CTATTCACCCTGCACTCGATTAGTATGCCTGCCTACGCCG
AGCTACCCACAAACCAGTTAGCTAGCATAATTTCACCTAT
AGCCAGCACAAAACATTTTCTCAATGTCCCGATAATCCAA
ACGGTTTGGTTGATAATCTCCTAAATGACGTGAATGTAAT
GAGCTCGGCGCTTCGGATCGGTCGGTTGTCAGTCCAGGTC
GGGTAATAACGATCCAGCTCGGCTAACAGGCTAAGCGGCT
AACAAGCGCCTTCGATGACATTTCACTGACAAACACAACA
AAACAGTTTGCATGGCCGGCGTGCTGCTGAGTTAGTGTCC
GGTCCGCGTGTGAGGGAGGCCGGCCGGGCCGTGGAGCACT
AAAGAGGAAAAATGGCTGTGCAGAACAGAAACTCTGTGCT
GATCCTGTCGGGGCGAGAGCGAGGAGCTCGTATGCTGGGG
TCTCAGAGGCTCCTGCAGCAGCTGGTGGAAGACCGAACAC
GCTGGATGAAATGGCAGAGCCAGAAAGTAGAGTTGCCAGA
TAATCCACGATCAACCTTCCTGTTGGCCTTCAGTCCAGAT
AGGAATCTTGTGGCCTCAACACACGTCAACCATAACATCT
ACATCACAGATGTGAAAACAGGAAAGTGCCTGCACTCTTT
AGTGGGCCATCGACGCACACCTTGGTGTGTGACCTTTCAC
CCCACCATCCCTGGCCTGGTTGCCTCTGGGTGCCTTGATG
GAGAAGTTCGCATTTGGGACTTGCATGGTGGTAGTGAGAG
CTGGTTCACGGAGAGTAATGTTGCCATCGCTTCTCTAGCG
TTTCACCCAACGGCTCAGCTTCTCCTCATCGCCACTAATA
ATGAGCTTCACTTCTGGGACTGGAGCCGACCAGAGCCTTT
TGCTGTAGTCAAGACGGCCAGTGAGACCGAGCGTGTCCGG
TTGGTGAGGTTTGATCCTCTTGGTCATAATTTATTGACTG
CTATTGTGAACCCATCAAACCAGCAGAATGAAGATGACTC
TGAGGTCCCCATGGATAGTATGGAGATGGCTTTGTTTCGG
CAACGTTCCCTTTTACGCTCCCCGCCTGTACGTCGCACAC
CAATCCTGCACAATTTTCTCCACATCTTGTCCTCTCGCTC
TTCAGGGGCACAGGCTAATGATCAGTCCCGCCCTGCACCA
GAGCCCCGGGAGCCTCCCAGCATACCACGGTTCCAGTACC
CTGTGCGGACAGAACCGGCTGACCGCCCTGCCTTACAGGG
CTGCACGCAGCATTTGGGTCTGGGCTGCCTGTGCAGTCGC
TGTGCTGCCTCACGGAATTTATTCACACAGAATCCGACAG
GCCTCCAGCCTTCAGATTCGACACAACCACAAACTCAGTC
GGGTCCCTCTGCCTTCTCGCCCGCTCCTAGTCAGACTCGG
ACCTCGGACCGACCCTCTGCTTTTAGCAGTGTGTTTAGCG
GGACTGCAGGGAACTCAGCACACCGGGGTCTTCTGCCTCT
TAGGACTATTGATCCATTGGGATCACAGGTACCCAGCCAT
CTTGAGGCCCCTGGACGTCTCCCAGGGGCTGATTGGTCGG
GTAGTCTGCTGAGCACAGGACATGAACATGGGTTGGGTGC
CATTGGGGTAGAAACCAGCAGTGGAAGGGGTGTAGTTCCC
CCTCCTAGGACGAGCTCCTCTTCTATGGATCTTCTTTCTT
TGCGCAGGTTTCCCGATGGTTCTTCTTCATCACCTATATA
CACATCTGCAACTGAAGGCCGGGGCCTTGTGCTCCCTGGC
ACGGAGCCTAACCGGGGGCGACCCAATGATGGAACAAGTA
GTGGTCACCACCCTTTTTATGACAACACTCAACGCAACAA
CCCCGCATCCATACGCAACGTCTTGCAATGCAACCTGAGC
CGTTACTTCATGGAATATGAACGCATGCAGGAACTGGAGC
GACCTGGTGGTAGTCGAGAGGTGGCGGGTGGACCTGGACC
CATGCAGGAGCTGCTCACCAGTAGCATGGATGCAGAACGG
CCTGGGCCATCACACAACGGCTCTTCCCACACTGGAAATG
GAGGTGCAGTTGCTACCCCCTCTCAAAACCACCCTAATCG
CTGCCGTTCGTGTCACAACCTTCTCACCTTCAACCACGAC
ACTCAGCGCTGGGAACGTTCTGGTCAGACCTCTTCTTCCT
CTTCCTCTCAAGAAGGACCATCCTGGCCGCTTTCAGTGCC
TCCGTTTGAGGATCCGGGTCAGACTGCACGAGTGGAAGCA
CAGGCCCCTGAGATGAGGCCCATGGAGTTGGGCGAGGCCT
CTTCTGGTCTGCAGGGCCAGCAGCCTATGGGTCTGGTGTA
CAATCAGGAAACAGGGCAATGGGAAAGCGTGTACCGGCAA
CCAACAGTCAGTGCCTCATCTGAAGCAGCAGAAGACGCCT
TAAACCCAGAGGTGCCTGTTGATAATCCTGATGAGGACTC
GCTCAGAAGGAGGTTACTGGAATCGTCACTGTTTCCATTC
TCTCGGTATGACATGTCTAGCTCCAGAGATCATCCCATAT
ACCCTGATCCTGCCAGGCTGTCTCCTGCTGCTTACTATGC
TCAAAGGATGATCCAGTATTTGTCTCGGAGAGAAAGCATA
CGCCAGCGTTCCCTGCAGAATCGCCTGCGGACGCTCTCAA
ACTCTCAAGCCGACAGCCAGTCCAACAACCCTTCCTCCGT
GCCACCAGAGGCCAGTGATGGAGATTATGAAGACATCGAG
GAGCCTGGAGACAGGACAAGGCACCGAATGCCCCGCAACG
CCCGAATGTCAGCCCCTTCTCTTGGACGCTTCGTCCCACG
GAGGTTCCTGTTACCAGAGTACTTGCCTTATGCTGGACTC
TTTCATGAAAGGGGTCAGTCAGGCCTGGCCACTCACTCTT
CTATCAACAGAGTATTAGCAGGTGCATCTATAGGTGACGG
ACAGTCAGCTGTGGCCAGCAACATTGCCAACACCACTTAT
AGACTGCAATGGTGGGATTTCACCAAGTTTGATCTCCCAG
AGATCAGCAACGCCACTGTGAATGTGCTGGTTCCTCACTG
TAAGATCTACAACGACGCCAGCTGTGATATTTCAGCAGAC
GGGCAGCTTCTGGCTGTGTTTATTCCCAGCAGCCAGCGGG
GTTTCGCGGATGAAGGCATATTAGCCGTCTACTCCCTCGC
CCCTCATAACCTGGGAGAAATGCTCTACACCAAGAGATTC
GGTCCAAACGCAATCTCGGTGAGCCTTTCCCCCATGGGCT
GCTATGTGATGGTAGGACTGGCCTCCAGGCGGATCCTGCT
CCATCCCACCACCGACCACATGGTGGCGCAAGTGTTTCGT
CTGCAGCAGCCACATGGAGGAGAAACCTCTATTCGAATGA
TGTTTAATGTGGTCTATCCAATGGCTCCAGATCAGAGGAG
ACACGTCAGTATTAACTCTGCCCGGTGGCTTCCAGAGCCA
GGCATGGGATTGGCCTACGGGACCAATAAAGGCGACCTGG
TCATTTGCAGGCCAGTTGATTTCCGCAGCGATGGAGACAA
TCCGTCAGATCTGAATGCAGATTCGTTGTTTACCATCAAC
AGCAGCAGCCGAACCCGTGGAGTGGAGCGACCAGGGACGA
GCAGGTCCGGCTGGCGGTTCGACCGAGATATGGGCCTAAT
GAATGCTATTGGCCTGCAGCCGCGTCAAGCCGCCCCTTCA
GTGACCTCACAGGGGACGCAGACTCCAGTGGTGCGACTGC
AGAATGCAGAAACACAAACGGAAAGAGAACTTCCTTCAGC
CAGCACCTTCCAGAACACACACACCACATCCAGACACACG
GTTCAGACGGCCAGCACCAGCACTGAGAGACACACACACC
CAGAGATGACACACACACTGGTTCAGGCATCAGTTTCAGA
GGGATCACTGAACCGGACCAACTTGCCCGCCACATATCAC
GTGGAATCAGCAGCTGAGCCCGGCACAGGAGAAGACGCAC
TTTCTCGAATCCGCCGCCTAATGGCAGAAGGAGGAATGAC
TGCAGTCGTCCAGCGGGAACGCAGCACTACGATGGCCTCT
ATGGGCGGCTTTGGAAACAACATAGTGGTCAGCCATCGAA
TTCACCGTGGCTCACAAACTTCAGTCAGAACAGCTCAGGG
GGGAAACCCGACCCCTGAAATGCCTGCAGGCCTCGGTGTC
TCGACACTCTTTCACACTGAGCCCTTGGTAGACTCTCTAG
AAGCTCCTGGGCCATCAGGGTCCAGTGGTGCCCCACTTCC
AACACCGTTTACAAACCGCTCCGAGTTCGCAGGAGTGTCT
CCTATGGTGGAGTCGGACTTGTTTGGTGATCGTCAGCCCG
ATGATGTGCAACGCCGCCCATCTCGTGGTGGGTTGAACAT
GTCTAACCATAGCAACAACAATAACAATGACCATAGCAAC
AGCTACAGCGAAAGCCGGAGTCGAGATTACCCTGACGACC
TGTATGGCAGATAGTCTCAAGTTTGGTTTTCTCAGAGGCG
AAAATCTCAAGACTGGTCTGCATGGTGCTGGAGCGGTTAC
ATTGACAGAGCATAGCGTTTTGGGGCGGAGCTGCTGAAAT
TCCTGCCTCAGTTGTGACTCCTCCCACTCTGGCCTTATTT
GGGAATGAATGAGTGCCAAGTTTCATGGCGTCGTCTCCTT
GAATGGGGACACGTCAGCCTCACCCTTTCTGTCAAAACTG
AACACTCGCTTTGAGGAAGCATCATTATTGCACTTGCGCG
TTGCACTTAAGTTATAATTTTTCTTCTTTCAAGGTTGAGA
CATTTCATCATTCCATGCGAGAAAGGGCATCATACTTGAA
TCCTTCCCGTGCTGCGGTACGGAATTACACGGTTGTAGTT
AAACACCCTTTCGAGCTCCAGGAAAAATCATCAGCCAATC
GAAGTGCCAGTTGAGGCTGGGGGGCGTGTTCCTATCGGAT
CCAATGGGATCCACTGTCTTCAGGACCGTTTCGGTTTGAG
GAACTGTAAAGCAGTACGGACTCTTCTAGGGTTGTCACGA
TACTGGAATTCGGCACCTATCGATACCGTAGTAAACGTCA
ATTTCCTGCAACCGTTTAAGCGCTACTGAGCATCTTCTTA
AACGTTGCTGATTGGCCATTGTGTTCACGTTCTCAACAGA
AATGATTGTGATTGGCCGTGAAGCTCATCAGTTAACCGAA
CTCATCACTGTTTACTTAGTGTAACCAAAGATACAGGGCT
GAGTGTTTCAAAGTCACATCAATCAGCTGGTTTGTCTATA
CGTTGGCATTTTAGCGGTCCACTGATGAATCGTGGATTCA
GAACGCTCCAGTGTCCCTGTATCTGTGGTTCAGCTCAGTA
AACAGCGGTGTGAACTGATGACCTTCACGGCCAATCACAG
TCATTTCTGTTGTGCACATGAACACAATGGCAAATCAGCG
CCGTTTAAGAACGCAAATGTTATTGTCAAATGGACGTTTT
TAAAATTGCAGTGTCGATTGGTAGCGAATTCCAGTTTCGT
CCAACCCTAGACTCTTCACAGCTTAACACTAACTCTCCAC
ATCATCCTCTAACGGTTTTTGTGTTCAGATAATGCTTGAT
GTGATTGTTTTTATTTTGTGATGGATAATGTGACTTCCAG
TGCTCGAGTCATCCGGTTGATCGGCGTCTAGAACAAAGTC
TGCTTTTAAAGTTCTCAGACTGGAAAATCGTGCGAGTGTG
TCCCACTTCCAATTTTACGACGGTTTTAATTTATGTCTTT
TGAAAAGAAAAAAAAACTCTTTTAAAAGCATGTCGTCTGT
AACTGTCCATTGGTTAAAATAAGCAGGAACCCTCATGGTG
GTTCGGATCTTTCGCATTTGCATGCGTGTCCAATTCCAGA
GCTTTTATATGAGGCAGGCTGACACTGAATGCAGAAGGCG
GGGCTTATGCAGTTTAGCATGTAGGCTGTTGAACACACAT
TTGATATTTTTGGTGTGCGAAGCAAATTTTATTGGCCTTT
TTATACATTTGTGAACATTAAAGCAAGAGTGCACCCAGCA
AACAGAATTTGGGGTTAGTAGTTCCACTCGCCGGCTATCC
TTTATGTCAGCGATGTTCGGCAAAGTGATTCTGATTCATA
AATTCCAGGTAAACTATTACTTTCAATGTCAGCATAGATT
AAAACACATACAGGCAAAACTAAATGAATACCCTTTGGTT
TCTGATGATATATTGAGGTCTTATGGTGCAAAGTGATTGA
TCTGTGCAAGGAATTACACCATTTATTACATTATCTTTAC
TATAATGTTCAGTTTCATGCACAGGCCAATTATTATCTTT
GCAAAACCCAATGCATCGACCCATGTTTCATTTTGTTTAG
CTGTTTACTTGCATTTTATTGATCAACAAGTAGCGCTGTT
TTACCTAAAAATGATCATTAATATTTAACTGATGAGAAAA
GTTGCCTATATCTTGCCCTGAGAGGTTTTTTTGGGGTGAA
CTATTCCTTTAACTTGTGAGTGTGTGTTTTAGAGTTGTCA
CGATACTGGAATTTGGTACCAATCGATACTGAAATGTTAA
AAACGTCAATTTCTTGCTAGCATTTGAGCACGTTCTTAAA
CAGCGCTGATTGGCTATTGTATTCACATGCTCCACAGAAA
TGAATGTGATTGGCTGTGAAGGTCATCAGTTCACCAAACT
CACCCGCTGTTTATGGAGTGTAACAACAGATACAGGGACA
ACGGAGCGTTTCAAAGTCAAGTCGATCAGCTGGTTTGTCT
ATAAGCTGACATACGCTGATAAATTTTGGCTTTAAAATAG
TCCAGTGTGCCTGTATCTGTGGTTATACTCAGTAAACAGC
GGTGAGTTCGGTGAACTAATGACCTTCACGGCCAGTCACA
GTCATTTCTGTTGAGCATGTGAACTCAATGGCAAATCAGC
GCTGTTTAAGAACACGCTCAAATGCTAGCGGGATATAGAC
GTTTTTAATATTGCATTATTGATTGGTACCGAATTTCAGT
ATCATGATAACCCTAGTGTGTGTGTGTCTGTGTGTGTGTG
TTTGTGAATTTAAAGCTTTGTTGCAATATGACTTCACAAC
GCATTTTTATGAATCCCGCTGATTTGATTTCCCAGAAATA
GCATTACAGCTTCAGCGGCGGAGCTTATACTGCAACAATT
TATGCTGCTGTTTATCAAATCAGCTCAAATCCCCTCCCCT
GATTGGCCAATGACTTTTGTTGAGTTCCACTAATCACCTT
TTATTTGCATTCAAGACAGGATAGCAAGCGATTGCACTTA
AGCGCCCTTTTTCGTTTGGAGAACAATGTTACAGAAAACA
AACCAGACACGTTTCTATAATAGATCTGGATTATGATAAT
CACACTTGAATACCCATTTGGGAAATGGACGCTTATATAT
GCGCACAACGATGAGAGTAACTGAGAACGGGGGCACTGTG
TGTGTGTGTATGTGTGTGTGCGTGAACGTGCAGAGTTTTA
TTATAAATAAATGTAGCATTGTAAATGTAGAGATGATAAA
TCAAGAAAAAAAAATCCATATTTGAGTGGCGGGGTTTGGT
TTTTTTAATGACATACTTGCCTTCTGAGCTCTGTTGTGCT
TGTTTAGATTCTAGCCTACGATTGGTTGAAGAGTTGTCGA
TGCATTTGCATACACCTTTCGTTGACGAGCATTTATAATC
TCCCTCTGCTTTTTATTTGTGTAAAGATTTCGGTATTTTA
GCTGCTCGGCTTGAATTAGTAGCTTTTTTCTAAAAAAACA
AAACAAAAAAAGCTGTCCCCAGTAGGAAGGGTTTGTGTTT
GGAACGTTTGTGGATGTAAGATTGTGTTGAATTGTGGTCT
CGTAGCAAGCAATGGCAGCTGAGGAACCTCTCGGAAACCA
TGTGTTCAGTGCCTTGAGGAGATTTCTCCTTTTACTGAAC
CACAAAAAGCCGTTCTGATGCTCGACAAAACCAGAATTGC
GCCTTTTGAATGTTGAGTGTTTTAGATATTGATAGAAATA
TCGGTAAAAACTACGGTCTGGATGTCATTTGGATTATTTA
TTTGACCCTTTGTGCGAGTGACAAATGCAATCCTGATTAT
TATTATTTTTTTTTTAAAGCTTCTGTGGTAAGAGAGAAGG
ACCTTCTTGCTTTTAACTCTTTGTATCCTCATCATCATCA
TCGTTTAAGGACATGTCTTTCACTCATTTCTGACTGTATG
CACATCCTCTGAAGTTGCTTCATCCAGGGTTTGTTTTAGA
CTTTTAGGCCTCCTGACAATTCACCTGAGAATTGCTGTCG
GCGACCAAAAGTGTGCGATTTTTAAAAGCTGTACCCGTGT
TCTTGTTGGCTGTGTGGTTGTGTATATGCTCCTACTGCTG
GATCGGTACCTTAGCTGAAGTCATGATGATGATGGTGGAA
AAGACCAGAATTAAACCTCCTCCTGTCCAGACATGAGGGG
AACGTGTTGTTTTTTGGCTTAGCGTCAATGTGTAGTTGGT
TCTTTATTTAGTGGAAAATAAGGATTAGGTGTTGTGAAAG
AATTTCGTGGGACACCAAAGATCCTGTGGTAATGATGATT
ATGAGAGTTTTAATAAAATGGGAATATGGAAATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations