Transcript

hhipl2-201

ID
ZDB-TSCRIPT-131113-810
Name
hhipl2-201
Previous Names
  • ch211-202f3.1-001
  • hhipl2-001
  • si:ch211-202f3.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055767 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055767|OTTDARG00000038889|ZDB-GENE-131120-145 hhipl2|OTTDARP00000043727 CH211-202F3.1-001 LG_ BX088653.6 Danio rerio protein_coding PUTATIVE, 3756 bp
GAAACAACTACACTCACATTTCCAAAATGAAGTAGCCTAA
CTTATCTAATTGTTACTAATATAATTTTATTGGTTTTTCT
TTATTTATTGTTTACGTTGATTTGCGTGAAAATGTGCATC
CGAAAATCCAGCAATTATATTGCACACGCGCTCCAAAGCG
TTGGACAAGCTCGCGCACGCACACACACACATACACACAC
ACACGCGCGCACGCTGAAGCAGTCATACTGTACACATAGA
CCCACACACACATACGCTGAAGAGCAAACACACTCCTTTA
CTCCAGAGCACACGTCAAAAATGCCGAGAGAGCCGGACTC
ACTAAATCATCTCCGTTCAAACTGGCCTGAGGGAAGTTTC
CTGACCAAAAAGACCAAATGGCTCCAAGGACTCATTATAA
CCATTTACTTTTCTTATTTGAGACGTGTTTTAGCGCATCC
CCAATGTCTGGACTTCCAGCCACCTTTCAAACCAACTTCA
CACCTCGAGTTTTGCAGGCACTATGAGAAATTTGGTTGTT
GCGACCAGAAAACGGACAGCAATATTGCGATGAGATACTG
GGATATAATGGACCTGATTGGTGAAGAAGCTTATGCAAAG
TGCGGTGATTTGGTAAAGGACATTATGTGTCAGGAGTGTT
CTCCTTATGCTGCGCACCTATTTGATGCTGAAGACCCATA
CACTCCAGTGCGCCACCTGCCAGGACTGTGTTCCTCCTAC
TGCGCAGACTTCCACAGCAAGTGCCATTCTGTGGTCAAGT
ATCTAACCAACAGCCGGACCCTGCAGGAGACATGCGAGAG
AGACCCCTTGCATTTCTGTAACCTCATTAATCTCCCTGAC
CAAGACTATTGCTATCCTAATGTTGTGAGTAACAATAATC
TGTACAGCAATCTGGGCAAGGTGGTGGAAGACACCAGAGG
CTGCTTTCAGCTGTGCTTGACGGAAGTAGCCAATGGCCTG
AGGAACCCCGTGCTGATGATTCACAGTGGAGATGACACAC
ACCGCATGTTTGTGGCAGAGCAGATAGGATTTGTATGGGT
CTACCTGAGAGACGGCAGCCGCCTGGAGCAGCCTTTCCTG
GACATCAGCGGGGAGGTGTTGACCACGCCATGGCTAGGAG
ATGAACGAGGTTTCCTAGGTCTTGCCTTTCATCCAAATTA
CAGAAAAAACGGGCGCTTCTACATCTACTACTCCATTCTG
ACTAACGGAAAACTGGAGAAAGTTCGCATCAGTGAGATGA
AAGTTTCAGCTCATGACATGAACATCGCAGACCCCTATTC
TGAGAGAGTTCTTCTTGAGATTGAGGAGCCTGCAGCAAAC
CATAATGGCGGGCAGATTCTGTTTGGTCTAGACGGATATT
TGTACATATTTACTGGAGATGGCGGGAAAGCAGGAGACCC
CTTTGGCAGGTTTGGAAATGCCCAAAACAGATCAGCACTG
CTGGGAAAAGCCCTTCGGATTGATGTGGATGGCAGAAGTA
TAGATGGGAAGCCCTATAGAATTCCTCTAGACAATCCCTT
TCGGAAAGATCCTGATGCAAAGCCAGAGGTCTACGCGTAT
GGTGTGAGGAATATGTGGCGCTGCTCGGTGGATCGGGGGG
ATCCGCTTACCCGTTACGGCAGAGGGAGAATCTTCTGTGG
AGATGTGGGTCAGAATCGGTATGAGGAGGTTGACATCATT
GTCAAGGGAGGAAATTATGGATGGAGGGCCAAAGAAGGCT
TTGAATGCTTTGATATGAAATTATGCCAGAACTCTTCTCT
AGACGATATCCTTCCGATACATGCCTATGGACACCATGTT
GGGAAATCCGTAACTGGAGGTTATGTGTACAGAGGATGCG
AATCACCAAATCTCAATGGACTCTACATATTTGGAGACTT
TATGAGCGGACGATTAATGGCTCTGGAGGAGGATAAGAAA
ACTGGGAGCTGGAAGGAAAAGAATGTGTGTATGGGCGACA
CCAAAACCTGCTCTTTTCCTGGCCTTATAAATCATCACCA
CAAGTTTATCATCTCATTCGCTGAGGATGAAGCAGGAGAG
CTTTATTTTCTGGCGACCTCCTACCCCAGTGCAATGTCTC
CATTTGGCACCCTTTACAAATTCGTGGATCCGTCCAGGAG
GGCTCCTCCAGGTAAATGCAAATACAAGCCACTTCCTGTA
AAGGTCCGAGGGAAGAAAGTGCCATTTACGCCTAGAGAAC
TGACTGTGCTTGGCATAAGTGAAACACCTACGAGATCCCC
ACTGGAAAAGATCATACGGCCCACTAAACCACCGGGCACG
CGCCAGCCCACAAGAGCCAAACCCAGCACATCTGCAGCAA
AGAAAAAAAAAACAGGCCAAACCACTACAGCAAAAATGAG
CCAAGAGAAGTCAGAGAAGGCAACTCAGCAAAACAAGAAG
AAAGTGAACGTGAGCATGAAAACACAAAAGAAAGTTCCCG
CTCATAAGAAATTAATGCCACAATCCAAGAAGGATAAAAA
AGCCCCTGTAAAACCGTCCACTGTAAAACCCAAACAGTCA
ATTAAAGGAGCTCCGGAGAAGAAGAACATCAAACCACTTA
AACCTCAAACGAAACCAAAAGTGGTGACAAAGCCCAATGT
TTGGTTACAGAAGACTAAAAAGAATGGACAAGAGGTGAAG
AAACCTGCGAAGAGCCAACCTGAGGGGACTGTTACTAAAA
AGACCCAAGCAAGCAGCAAAAAGACAAAAAACAGCATTCT
CACGAAGAAGAAAAAAGCTGTTTAAATGGGCACGCATGTG
GTGTAGTAATTAGACGGTAGTAATGTAGCGCAGTAATGAG
AATTCAAAGATAGCCCGTTCAACAATGTATCAATGAAGTT
TTTGGCTCTGAGGTCAGTCAGATGTGTGAAGTGAAAGGCC
AAAGAGAAAACCGCAACAGTCCTGCTCCAGCGGTTGATTC
CCTTTAGCATGCAACACGGGAGCATTCTTCAGATGCTGAG
CTTATTTTTGGAATGCGGTCGAGTAATTAGTTCGGATCTC
TATTTTAGCTCAAGACTAAAATTATATAGAGAAATTCTAA
ATACAAAAACGAGAATGCTGTTGAAAGACTTTCTTAAACA
GAACTCTTTGAAACTAAAATACGGCGCATTGTAAAATGTG
TAATTTTATGGCATACCTAAGGAAGTCTAAAATGCACATT
TCTGAAAAGTAAGTGGCATTGCGTTTCCCTTAATAGACAC
AGACAGAAGGCATATCTCTATATATATACACCGTCCATAG
TTTTTTTTTTTTTTTTTTTTTTCGTGGTGCAAGCAAAAAT
GGTTCATTCAATAAAGTCTTTTGGCTTGTTTACAGTAAAA
TCCTGTTTGATGTTGATCCAAACCAAGTTTATATGGGGGT
GTAAATTAAGTATTACTTATTGCTAAACCTCAGTCCCTTG
GTTCATGTGAAGTGGTAGGGGTATCACGATTCTCTTTTGC
TTGGAGGTTTAGGGGTAAGGGCAGACATTTTCTTGACAAT
TAAAAAGTGAGCTGTGCTTTTTATGTTGCTAGGCAACCTG
TTTGAACACTTAGCACTGGAGCGCAAGACATCGGGCACTT
TTTCAGCACAGAGTTGATGTTTTTTTTTTTTTTTTCTGCA
GGCATACAGAGCGATGTGTATAAAAAATGAGAGGTGCAAT
GTTGTGTTTCTCCTGGCATGTTGAGAGTGTTTTCAGTTCA
TTCATGCAGAGGATTTGCATTGTGACTCATGCAGAGCATT
ACGCTCAACTTCTTCCATATAAATGAATTCAAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations