Transcript

prlh2r-201

ID
ZDB-TSCRIPT-131113-768
Name
prlh2r-201
Previous Names
  • prlh2r-001
  • ch211-210h14.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055626 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055626|OTTDARG00000038786|ZDB-GENE-120411-41 prlh2r|OTTDARP00000043621 CH211-210H14.4-001 LG_ BX649281.7 Danio rerio protein_coding NOVEL, 1121 bp
ACCATGGCGGACATGGACGACCTCCACAACGAATCCCGGA
GAAACATCTCTCTAGATTTATCCTCCTCATCCTTCACCGG
ACTCCAGCTGCTGATGGATCTGAAGCCACTCTTCATTCCA
CTGTACACCATGCTCGTCCTGATCGCCTGCTCTGGAAACC
TGCTCCTCCTCATCCTCATCGGCCTTAACAAGAAACTCCA
CAGCACCACAAACTTCCTCATTGGAAACCTGGCCCTGGTC
GACCTGGTCATGTGCCTGTTTTGTGTCCCCCTGACAGCGT
TTTACGCCTTTGATGAGCGCGGCTGGGTGTTTGGCCAGTT
TATGTGTCACTTTGTTACTTTGATGCAAACTGCGACTGTA
TTCGCTGCAGTCCTTTCGTTGACCGCCATTGCCGTGGACC
GATATGTAGTGGTTGCCTACCCAATTCGGCGGCGTGGAGG
TCGTTGGTTTTGCGGATGGCTGGTGGTTAGCATTTGGCTC
TGTGCACTAGCGATGTCAACTCCCACCGCTTTACACACAG
TCTACTTGGATCTCAGTGAAACAGGCCATGAAATGGCGGT
CTGTGAGGAGTTCTGGCATGGTCAAGAGCTCAGTCGTCTG
ATATACTCTTGTTTTTTCCTGCTTCTGTCTTATTTTGTTC
CTCTGGCTGCAGTTTCCATATCCTACTGTGCCATCTCGTG
CCACCTGCAGCACAGAGCTACACCTCGCCTCATGGCAGCT
ACACCTTCCAACCAGGAGAAATGGGGACGCAAGAGGCGGA
AGACATTTCGCCTGCTGCTGGTGTCTGTTCTGTCGTTTGC
CTTCTCCTGGCTCCCACTGCAAATAGTGAACCTCATTCGG
GATCTGGACACCGACTTCGCCATCCTGAGCAAGAATCACG
TCAATGTGATCCAGGTGTCGTGCCACTTGCTGGCCATGAG
CTCGGCTTGCTACAATCCTTTCATTTATGCTTCACTGCAC
AAAAAGTTCCTGTCATATCTGTGCCACAACATGTTTCAAA
AACGAAAAGCTCACTGCACGCAGAGCAGCATCACCACCTC
CAGCCGAATGACTCGCTTGAACACTTGCAGCACTCTGGCT
GACATTCCCATGGCCATTAGTAAGACTTCACAGGATTGAG
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations