Transcript

pla2g4f.1-201

ID
ZDB-TSCRIPT-131113-717
Name
pla2g4f.1-201
Previous Names
  • dkey-59k9.1-001
  • pla2g4f.1-001
  • si:dkey-59k9.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055425 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055425|OTTDARG00000038664|ZDB-GENE-131121-408 pla2g4f.1|OTTDARP00000043472 DKEY-59K9.1-001 LG_ BX927351.14 Danio rerio protein_coding PUTATIVE, 3366 bp
CATGAACAATCAACAATGACAATACTGGCAACATTAACAC
ATGTCACAAATATGCTTTCAAGAAAATAGGGTGATTTTAA
TGAGTCAGATGAATGAGTCGCTAGCCATAATCTCTTATCT
TGTGACATAGGTTTGAAAGAGGAACAGTGGTGAAGCTACT
TATACTCAGCCAGACAGAAGTAATCTTTCTAAAGCAACTT
TGTGTTCGTTGACTTGGGCACTCTCACTTGCGTTTCAAGG
ACAGCTGTATCCAGATCTCCACACAAAGCTCCAACAATGC
TTAAGAAAGAAGCCAAGCCATACTGGAATCTGTCTGTCAA
AGTTTTGCGCGCAAAGATCCATCAGTCCTACGACTACTTG
AATGAATCTGACTGCTATGTCATCCTGAACTTACCCACGG
CATCAGCCCGCACAAAACGCACCAAGACTATCCCAAGTAA
TAACAACCCCGAATGGAATGAAACTTTCACTTTCCGGGTG
TTCAGCAACATTAAGAACGTTCTGGAGATCATGGTCTATG
ATGAGGATCCATTCATGAGAGATGACCAATGCGGCACAAT
CCTATTTGATGTCAATAACCTCACTCCAGGGAAAAAGGAG
ACCAAATGCTTCATAATAAATGAAAAGACCAAGAATGAAC
TGTGGGTAGAGTTTGAGATGACTAAAAGCTCTGTGACACC
AAGACCATGTACATCTAATGGAGTGTTGGTGGCAGGACCT
TTTTGTGAGCTGAACGTGGAGATAGACAAGCTTCTTAAGA
ACTCTGAAGCAATTCAGAACATGGTGTTAAAACTGAAAGG
GGCATATAAAGAGGATATTGTGATCTCAAATTTGGATGAA
AGCTCCAGCATCATGACAACATTACGTTACTTCATTAACC
GAGATCTGGAAACTGAACTCAATCTAACCTCCGAGGCAGC
TGTCAGGCCAGAAAATACTGTCGTAATGGATGGTACAGTT
CCAGCTCTTGTAGATGCTGAACTGACTTCTGTTCCTTTAA
AACCACTTCCAGCCAAACAGAAGCTTACTGTCTCTTTGCC
TCTGGGAGAGAATAAAGTGGATCTGCAACTGAAAACAGAT
GATCGCTCTGATGAAGAGATGGATGTGCGTCTGGATTTTG
ACATTCCAGAGGAGGAAAAAAGATTTCTGGCAAAGAGAAG
AAAAGTTGTTTCACAAGCACTTCAGAAAGCTCTGAATCTC
AGCTCTGCACCAGATCCAAGCAAGGTACCGCTGGTGGCTG
TGGTGTGTTCGGGAGGAGGGAGCAGAGCTTTAACAAGCAC
ATACGGAAGCCTTAAGGGTCTGCAAAATATCCAGATTCTT
GATACAGTCAGCTACATCACAGGGGTTTCAGGTGCCACTT
GGGCTTTAGCCTCTATTTATGAAGAACCGAACTGGTCAAA
GGGTGACATTGATAAAACGATGGAGTCTGTAAAGAAGGAG
CTCTCTAAAACCATATTCAGTTTGTTTTCTTCGGAGCAGC
TACAGCGATACAAAGAGAAGATAGATGAGCGAGAGAAGCA
AGGACACATTGTATCTCTCATAGACATGTGGGGTCTGGCT
TTGGAGTATCTTTTCCGGGGGAAGAAGCACATGGGAACAC
TCTCTGAACTGCAGAGGACTGTGTCTGAAGGCCAGAATCC
TCTGCCTATCTTCACATCTGTCAACATAAAGAATGGCAGG
ACAGAAAGTATAGAAGATGCAGAATGGTGTGAGTTCACTC
CATACGAGGTTGGATTTCCCAAATATGGTGCCTTCATTCC
GGCACAGAACTTCGGGAGTGAATATTACCTTGGGCACATG
ATCAAGAAGCTCCCCGAGACTGCACTCTCCATTCTTGTGG
GAATGTGGAGCAGCATTTTCTCTGTAAATCTGACAAACAT
CTGGAGTATAGCCACGGGAGCCGCACCTTCCTGGACTCCT
CAGGTTGAAGGAGGAAAGAGCAACACAGAGACTAGCAAAC
CGACAGCACTTACCACACACCTGATCAACCCGGTGACTGA
CTTTGCTAAAATGCTCTGTGGCTTTATGACCAGTCGTCCC
ATAGTCAGCCAAATGTTCAACTTCCTGAGAGGCTTCAACC
TGCACAGAAACTACCAAGAGAACACAGGCTTCATAGCATG
GAAAGAGAAACATCCGGATGCCTTTCCTAACACCATGACT
CCATCTGATCCAGTGCTGAGTTTAGTAGACGCTGGATTTG
CCTTAAATGCAGGATTTCCACCGATAGTTCGCTCTCACCG
GAATGTGGATGTTATTCTGTCTATAAACTACTCCTGGGAG
CTGGATCAATTTAAGGTCGTAAAGCAAGCCCAGGAATACT
GCACCGATCGAAAGATCCCATTTCCAAAAATTGATTTCAA
AAAGCTGGAGTCTGAGCCACTGAGGGAAGTTTATGTGTTT
GAAGATAAAAATAATCCTGATGCTCCCATAGTGCTTCACT
TTCCCTTGGTCAATGTCTCATTCAAACAGTTCAAAGCTCC
AGGAGTGAAGAGAGAGGGTGAAAAGGAGCTAAAAGAGGGA
GCGGTTGATGTTGACTTCAACAGTAACACATCTCCATATG
CCACTCACAAACTGACATACACACCGGAGGACTTCCAGAG
GCTCATTAACCTAACTTCCTACAACATCCAGAATAACAAA
GATGTCATTCTGAACGCATTAAACAAAGCACTGAACAGAA
ACAGAGACAAGAGGACAGGGGAAGATAGCAAAAAAGAGGA
GAAAGGAAAGACCTGTTCAGCACCAACACCACAACCAGGA
TCACAGAAAACACAAAAGACACAAAAGTAATCTGAATGCA
AAACTTGATTAATCTTAAATTGTTGTTGTTGTTACAACCT
ACTCTAATCATGTTTATGTAACTTACAACTAGGGAATGTT
ACTTAAAACTCACTAAGTTACATACATTCAACTCACAATT
GTGATTAGTGCTTGTGATAGACTCAAGGCAAGACATGCTC
ACTGCCAGAGCCACACATAGAGGGCAGTATATTCTGTAGT
ACTCTAGTATGCACTCTGCAGGAATGCTGCTCTGAAGGGC
CGAGAAGTATAGTTCAGTTTCAGAGTTTCCCCTTTGGTTT
GAGATACACTGCTGAAAAATAAATTGAACTTCTATTTTAT
TAACCAATTGTGTGTGTGATGAGAAGTATTGAGTATGTTT
TACATTTGCACATAGACAGCTTTATCTGGTATATGAAGGG
CAATTGCAATGACGTGTGCAATGTTTTTAAATGTAAACCT
TTGCCAAAAAGCCACAGCTATTGCATTATGAGGGTAGGGT
AGTGTGACATTTATGATGTCATAGGTAAGGTAATGGATGT
GTAGTTCCCAGCATGTTTTACAGAGAAAAAAAAGGAGAAA
ATGATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations