Transcript

oxtr-201

ID
ZDB-TSCRIPT-131113-616
Name
oxtr-201
Previous Names
  • oxtr-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055047 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055047|OTTDARG00000038422|ZDB-GENE-110805-2 oxtr|OTTDARP00000043170 oxtr-001 LG_ BX664752.20 Danio rerio protein_coding KNOWN, 1167 bp
ATGGAGGACATCTTCAAGGATCAAGACTTTTGGTCCTTTA
ATGAGTCATCCAGAAACGCCACCAATGAAACCTACGGCGT
GAACCAGACGGTGAATCCCCTCAAGCGGAACGAAGAGGTG
GCCAAAGTGGAAGTTACCGTGTTGGCCTTGGTGCTGTTCT
TGGCGCTCGCCGGTAACCTTTGCGTCCTTATTGCAATCCA
CACAGCCAAGCACAGCCAGTCTCGCATGTATTACTTCATG
AAGCACCTCAGCATTGCAGACCTGGTCGTGGCCGTCTTCC
AGGTTCTTCCTCAACTCATTTGGGACATCACTTTTCGCTT
TTATGGTCCGGACATCTTGTGTAGGTTGGTGAAGTATCTT
CAGACTGTTGGGATGTTCGCCTCCACCTACATGCTGGTGC
TGATGTCCATAGACAGATGCATGGCGATCTGCCAACCTCT
TCGTTCTTTACACAAGAGAAAGGACCGCTGTTACGTGATT
TGTTCATGGGCACTGAGCTTACTTTTCAGCATCCCGCAGG
TTTATATCTTCTCCCTACGGGAGGTGGGTTCAGGAGTCTA
TGATTGCTGGGGAGATTTTGTTCAGCCTTGGGGAGCGAAA
GCCTACATTACGTGGATTAGTCTGACAATATACATTATAC
CAGTGACCATTCTGAGTGTCTGCTACGGGCTGATAAGCTT
TAAAATATGGCAAAACTTTAAAAGGAAGACGAAGAGGGAC
CAGTGCATCACTCTCACACCCAAAGCATCCAAAGGCAACG
CGCTCGCGCGGGTCAGCAGCGTCAAACTCATTTCCAAGGC
CAAAATCACCACCGTTAAAATGACTTTTGTTATCGTACTG
GCTTACATAGTGTGTTGGACTCCGTTTTTCTCCGTGCAGA
TGTGGTCAGCATGGGATCCTGAAGCACCGAGGGAAGCGAT
GCCCTTTATCATCTCCATGTTGCTGGCCAGTCTGAACAGC
TGCTGCAACCCCTGGATCTACATGTTTTTTGCTGGCCATC
TCTTCCATGACCTGAAGCAGAATCTGTTTTGCTGCTCCAC
GCTCTATCTGAAGTCCTCTCAATGCCGCTATGATCCAGAG
CAAGATTCCCGTAAGAGCAACTCCTCCACCTACGTCATCA
AAAGCACCAGCAGCCAGCGGAGCATCACCCAAACCTCCAT
CACATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations