Transcript

wwc3-202

ID
ZDB-TSCRIPT-131113-540
Name
wwc3-202
Previous Names
  • wwc3-001
  • ch73-367a15.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054675 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054675|OTTDARG00000038158|ZDB-GENE-070209-229 wwc3|OTTDARP00000042922 CH73-367A15.1-001 LG_ FP236326.7 Danio rerio protein_coding NOVEL, 3799 bp
CAGGATTACCAAGCCCCTGACCTTTGCTGACTGTGTGGGG
GATGAGCTTCCTCTGGGCTGGGAGGTGGTGTATGACCAGC
AGGTGGGCGTCTACTACATCGACCACATCAATAAGACAAC
TCAAATAGAGAACCCTCGTACACAATGGCGCCAGGAGCAG
GAGCGCATGTTAAAAGAGTACCTAGTGGTGGCACAGGAGG
CTCTCAATGCCAAGAAAGAGATGTATCAGATCAAACAGCA
AAGACTGGAGCTGGCACAGCAAGAGATGCAGCTCTTCAAC
CAGCTCACTCAGGATGACAACCGCTCCATCACCAGCTCTC
ACTCTGGTTCCTCTTCAAATGCAAAATATGACCCTGACCA
AATCAAAGCGGAAATCGCCTGTAGGCGTGAACGGCTCTCC
AGACTCAAACAGGAGCTGGCTCAGATGAGACAGGAGCTGC
AATACAAGGAAATGGGAGTGGAGACCTTACAGGAAATTGA
CCGGAAGATGTCCAGCAGTCAGACCAACTACAAGTTAGAT
GAAGCACAGGCCATCTTCAGTGAGCTCCGCAGCATTAAGA
AGGCCATCAGCACTGGCGAGAAGGAGAGGCAGGACCTCAT
CCAGAGCCTTGCCAAGCTGACGCTGAACTTCTGTGACTCC
ATTAATGAGGTGACAAACAATGCAGAAAGCCTGGCTGATT
CCTGCAGTGTTCAACAATACACGGACGCCGGCTGCCAGAC
GGACCTCATGGGAGAGTTTGGCAGCCAGGAGTCTTCTCTG
CTAGCAGACCGAGTCAAACTCAGCTGGCAGTACGAAGAGG
CCAAGAAAAAGATGTCCAGTATCCAGCATCAGTTGGCTCA
GCTGGATAGTGAGAGCTGGTCTGGTCGTGCCGAGGCGGAT
CGGGACTGGGACTGTCTGCAGCTGCTGAGGGAGAAAGAGA
CTCTGCTGCAGGAGCTCACTCTGCTCAGCCAACAGCAGCA
CTCGTCTGACACACTGCTCCAGCTGCAGGAGGAGAAGCGC
CGGCTCCAGGACGAGGTGCAGAGAGCCCACAGCGCTCAGA
GTCAAGGGGCCAACCAAAGGATTTTACTGCAGGAGAAGAG
GAATGTTCTTATGAGGCAACTAGAAGAGGCCACCCGCATC
ACCACGTATCTACACTCTCAGCTGAAGAGCCTGTCTGCCA
GTAACCTGACGGTGTCCTCCAGCAGCAGCCGTGGTTCTTT
AGCCTCCAGCCGGGGCTCTCTTGCATCCAGTCGTGGTTCT
CTGAGCTCTGTCAGCTTTACTGACATTTACGGCCTGCCAC
AGTACGACCGAACAGAAGGCAGCTCTGACGTCCTGGACCC
TTCTTTCCGCTACCTGCTCCCGTTGGAGAGCCACAGTTCA
GGTTCAGCCTACGGCCCGAAACGGTCCCATGACACACCGC
AGTCTCTGACCTCTCTCTCCTCCCGGTCCTCGCTCTCGTC
GCTCTCTCCTCCCAGTTCCCCCATGGACACCCCATACCAT
TCGGCTCCGCAGGACTGCCCTCTGGCTCAGATGACCGAGG
AGTACATGGAGGTGGCCAGCAGGGGGCTCTTGGCTGAAGG
GCTGCGGACCCAGAGTCAAGCCCAGCAGCACACCACGCTT
TCTGGGGATGGAGAAGTGGGAATCGCAGCCACTGCACACC
TACTGGAGGGGAAGAGCCACAGAGATGCTGCTCTTCAAGG
AACACACAGCTCCACAGGAGTGACCTTGCGCTGTAAAAGT
GCAAGTCGGACCAGCAGAAGAGCAAGACGAGTGTCTGCAG
GGGTAAATGAGGATGTTTTGGCAACAGACAGCGGGGTATT
TGAAGCCTGGAGTAGAAGCAGGACAGAAGAATCGGAAGAA
GTCAGTTTTGCTCAGGACGTTACAGTTGCAGTCTCAGAGC
CAGTTCATATTCAGATTGGCCTTCTATATGATTCAAATAG
CAGGTTTTTGCTGCTGCATGTTCTTCAAATGAGAAATTTA
AGCAAGGCCAGCATTAGAGATAGATGGAAAGTATTTGTGA
AGGTTCATGTTCTCCCGATGGACTCCAGTCGGCCCTGCAC
TTATTATTGCTGTAAGGCACAGGAGCCTCAGTCTCTGCTC
AGCTTTAATGAGAGCTTCCGGATCCCACTGAGTGTTGGAG
GCCCCGGGGCCCATGCCTTACAGTTCAGCCTCTGCACGCT
TGGACCCCTGGCTCAGGAGGAGCTGCTGGGCTCTGCTCAG
GTCTCACTGACAGACTGTGTAGGCAGCACAGAGATGCTCT
TCCAGTGGCTCAAAGTGCAGATTCACAGCACAGAGAACCA
CAGGCCTGAGCACAGACGCCTTAGTCAACCCAACCGCATC
ATGGATGAAGAAGAGGAGAAGAATGAAGGCCAAGGCAAGC
TAGAGGTGTCTGTGGTGAGTCATTTGGAGGAGATGAAGAA
AGAGTTACAGAGGAGTGAAGAGGAACTGGAGAGGAAAGAA
GAGCCGGGAGAGGCAGTTTCTGAAAGGAGTTGGCAGGCTG
AATCAGTGGACAGCGGCTGCAGTAACAGTACAGCGTTCGT
CATTCCCTGTCCTGAGAGTCTCTGTGGTGAAGGAATCTGC
CTGACTTCCGGGAGGCGCTGTCTCCAGCCTGCAGAGAGAA
ACCCAATTATAAAGGTGGACAAGGCGACCAACACAGAAGG
TGTGTTTGCTGAGCCGATGCGTATGCGACCGAAGGAAAGG
ACAGGCCGCTGGGGTCACAGCTCCCCCTTTATGCGCAGCA
GCACAATAGTCAGATCTCAGACCTTTTCACCTGGAGCCCG
CAGTCAGTACGTCTGTAGGTTGTACAGAAGTGACAGTGAC
AGCTCTACTCTACCAAAGAAATCCCCCTTCATCAGAAACA
CTCTGGAGCGACGGACTCTGCGCTATAAACAGCAGTCTCA
CCGCTCGTCTCTGGCAGAGCAGCCCACTCGCACCTCTCTG
GACCTGGAGCTGGACCTCCAGGCCTGCCGGACGCGACAGA
GGCAGCTGACAGAGGAGCTGGCAGCTCTGAGGGAACTCAA
ACTGAGGCTGGAGGAGCCCATGCAGGGCCCCCGTGGCCCA
GCTGACCTCCCACACTGGGCCCTACGGGACGAACGCTTCA
GAAATCTGCTGCGGGAGGCCCAGAGACAGTCGAAGCAGAC
GAGGCAGGAGCAAAGGCAGGAGGAGGCTGCTGAGAGGAGG
TTGAGAAAGGCTTCAAAAGAGGTCTTACAAATGAGGGGCC
AGAGCCACAAAGAGCCCCTTCCTGTGCAGACATTCAAGGA
GAAGATGGCTTTCTTTACAAGACCAAGATTCAACATCCCG
CCTCTGCCAGCTGACGACGTGTGAACGCCACACCATCAAA
TATGAAGAATCTGTCTGTTTTTTGTACTCATGCCCATGAA
GTAATTATAGATCAAAAGTGTAGTTATTTCAGCACAAAGA
TGAAAACTTATTTGATATGCAACTTTTGAAAAACAGAACG
CTGTAAAAAAATTAGCGTGTGTATGTGTGATTGTGCGTGT
GCGCGTGCATGCGTGCCTATGTGTGTGTGGTTGTGAGTGA
TGGTGAGTGTGTGCGATAGTACTAATGAACACATACACCT
ATATTTTATGTAATTATTGACATTTTGGCAAAATGTTTCC
TGCTTGATTAAAGTGGGGAATGAGTGTTTTATAAAAGAAC
AAAGCATCTTTTTACTCCTGTACATTGTACTTCTGATATT
TCGATGTCTACGCTTACTTAAGGCTGGAAGACGGGAACAA
AGTCAGTTTAGACAAATTCACTGTACTGTAACTTATTTTA
TAGTACTTTTCCTTGAAGGAAATAAAAAATGCTCCCTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations