Transcript

naalad2-201

ID
ZDB-TSCRIPT-131113-4486
Name
naalad2-201
Previous Names
  • naalad2-001
  • ch1073-184e5.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057912 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057912|OTTDARG00000040359|ZDB-GENE-040426-1025 naalad2|OTTDARP00000045356 CH1073-184E5.1-001 LG_none CU694529.8,CU693500.5 Danio rerio protein_coding NOVEL, 2395 bp
ACAGACAGTATTAGCTCTCCAACTTTCAACGAGTTATGAG
CGGCGTTTAGTCAAATGGGTTCTGAGGATAAAATAATCCG
CTGGATCTGCCGGCTAACAGCCATTACAGCTTTCTTCTTG
ATCGGCTTTATTATTGGTTGGTTTGCTCGACCTTCTTCTG
TCAATCATGAACGCACATCAAAAAGCTTCCTGCGCGACTT
TCTGGATGAGATGCATGCAGAGAATATTAAACATCATCTC
AGGAAGTTCACAAGGCTTCCACATCTGGCCGGAACGCAGC
AGAATCTGAATCTAGCAGAGCAGATACGCAATGAATGGAT
GGAGTTCGGGCTGGACTCAGTAGAGCTGGTTCCATACGAT
GTGCTGCTTTCATACCCAAATAAAACTAATCCCAATTACA
TCTCCATAGTGGACCAGCTGGGCAATGAGATCTTCAAAAC
CTCTCTAGCTGAGCCGGTTCCAGAAGGTTATGAGGACGTG
GCTGATATTGTCCCTCCGTACAGCGCGTTCTCTGCTAAAG
GACAACCAGAGGATGAGCTGGTGTATGTGAATTATGGACG
GACAGAGGATTTCTTTAAGCTGGAGCGTGAGCTGGGAATA
AACTGTACAGGAAAAATCCTCATCGCCAGATACGGCAAAA
TCTTCCGGGGGAATAAGGTGAAGAATGCGGTGCTAGCGGG
CGCTAAAGGGATCATACTGTTCTCGGACCCTGCGGATTAC
TGGGCGGAGGATGTAGAGCCATACCCTAAAGGCTGGAATC
TGCCCGGTGGAGGCGCTCAAAGGGGGAACGTGCTGAATCT
GAATGGAGCCGGAGACCCTCTCACACCAGGATACCCTGCT
AAAGAATACACATACAGGTCCAGTCTGGAGGATGCAGTGG
GCCTTCCCAAAATTCCTGTGCATCCCATCGGATTTCATGA
TGCAGTTCATTTGCTGCAGAATATGGGAGGACCTGCTCCT
CCAGACAGCTGGAAAGGTGCGCTTAATGTCTCGTACAGAA
TCGGACCGGGATTCACAGATGGTTTCCGTCAGAAAAAAGT
GCGTATGAACATCCACACTAACAATCAGGTGACCCGTATC
TACAATGTGATTGGCTGGATCAGAGGAGCAGTCGAGCCAG
ACCGGTACATTATTCTGGGCGGTCATCGAGATGCGTGGGT
GTTCGGAGGGATTGATCCTGTGTCTGGAGCTGCGGTGGTG
CACGAGAATGTGAGAGCGGCGGGAAAACTCATGAAAAAAG
GTTGGAGGCCGAGGAGGACACTGATCTTCGCCAGCTGGGA
TGCAGAAGAGTTTGGGCTGCAGGGATCCACAGAATGGGCA
GAGGATAATGCCAGAGTCCTGCAGGAGCGAGCGGTGGCCT
ACATCAATGCAGACTCTGCTATTGAGGGTATGTACACTCT
GAGGGTTGACTGCACTCCTTCTCTACACACTCTCGTTTAT
GACATTACAAAAAAGGTTTCGAGCCCAGAGGAAGGAGAGG
AGGGCATGAGTTTATACGAGAGCTGGCACAAACGAGACAA
CTGGCCAGAAAAAGACAAGCCATGGATCAGTAAACTGGGC
TCTGGGAGTGATTTTGAGGCATATTTTATCAGGTTAGGAA
TTATGTCTGGGAGGGCGAGATACACCAAAAACCGGAAAAC
AGAGCGCTACAGCAGTTATCCGGTGTATCACAGCGTTTAC
GAGACTTATGAGATCGTGGAGCGTTTCTACGACCCTCGAT
TTCGCAGACTGGAGGCGGTGGCTCGTGTTCGGGGCGGACT
GATCTTCAGTTTAGCCGATTCTGCAGTTTTACCTCTGGAC
TGTGTTGAATACGCCACGTCTCTCTCCACATACGCCAACA
GCATTCACCAGCTGGCAAAGAAGCATCCCGAGGCCATGCA
GCAGTACGCGGTCTCATTCGATTCGCTCTTCTCTGCAGCT
GAAAACTTCACAGTCGCGGCAAGAGACTTTCATCAGCGCC
TAGATCAGCTCGACTCCTCCAATGCTCTGGCCGTGCGGAT
GGTGAATGATCAGCTGATGTATTTAGAGAGAGCTTTCATA
GATCCGCTGGGTTTACCCGGAAGACCCTTTTACAGGCATA
TAATTTTTGCACCCAGCAGTCATAATAAATACGCCGGCGA
GTCTTTCCCAGGGATTTATGATGCTCTGTTTGACATCGAG
AACGCAGCGGAGCCGGAGAACGCCTGGAATGAAGTCAAAC
GGCAGATCAGCATCGCCGCATTCACCGTCAACGCAGCTGC
TGAAACGCTCAAACCTGTCGTCAGCGAAACTAAAACATCT
ATACACAACTAAATAATAGTACTCTAAACATACAATAGTG
ACTATAAGGGACTTGAGATTTGGTCTGGCTCTTAAGAGGT
GACTTATAGAATAAATAATAAACGGTCATCATTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations