header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4381
Transcript Name: usp32-201
Previous Name: usp32-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057386 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057386|OTTDARG00000040007|ZDB-GENE-100210-5 usp32|OTTDARP00000044975 usp32-001 LG_none CR848814.7,CU570780.4,CU633822.5 Danio rerio protein_coding KNOWN, 7476 bp
ATTCAGTATGGAGGCGTCGGCGCTCGGACGCGTCACTCGT
TGATAACGCAAAACTACCGCTTGACTTGATAGGAACACCA
TACCGAGGGTAAAAAAACAAAACAACGGAAAACAAGGCAA
CAGGCACCGGTCTCACTTTGCACATTTCTGACATTGCCAT
GAAATGAGGGCACCATGGGCGCCAAAGAGTCACGGATAGG
CTTCCTTTCGTATGACGAGGCCGTTAAAAGAGTTACCGAT
GTGGAGCTCAAACGTCTGCGAGATGCCTTTAAGAGGACCA
GTGGCCTGTCAGTGTATATGACCCAGCAATGCTTCTTCAG
AGAAGTCCTGGGCGACGGAGTGCCACCAAAGGTTGCAGAA
GTGATCTACAACTCATTTGGTGGCACATCCAAAGGGCTAC
ACTTCAACTATCTGATCGTCGGCCTGGTTTTGTTAACAAG
AGGGCGTGATGAAGAGAAAGCCAAATACATCTTCAGCTTG
TTCGCGAGTGATTCTGGCACCTTTGTGGTCCGGGAGGATG
TGGAGAACATGCTGCGCTCAGTGGATGGGGAGGTCCCGCC
TTCTCTCAGGAAGTGCTTTACTGAGGGGGAGAAGGTGAAT
TATGAGAAGTTTAAGAGCTGGCTGCTTCAGAATAAAGATG
CTTTCACGTTCTCCCGCTGGCTGCTGTCAGGTGGTGTGTG
CGTAACGTTGACTGACGACAGCGACACACCCACCTTCTAT
CAAACCCTGGCAGGTGTCACTCACTTAGAAGAATCAGACA
TTATCGACTTGGAAAAACGCTACTGGCTGCTGAAAGCTCA
ATCAAGGACAGGCCGCTTTGATTTGGAAACCTTTGTCCCG
CTGGTCTCGCCCCCTATTCATGCATCGCTGAGTGAAGGCT
TGTTTCACGCCTTTGATGAGAATCGGGACAATCATATTGA
CTTTAAGGAGATATCCTGTGGGCTCTCAGCTTGCTGTCGC
GGCCCAGTAGCGGAGAGGCAGAAGTTTTGTTTTAAAGTGT
TCGACGTAGATCGTGATGGAGTTTTGTCCAGGGACGAGAT
CCACGAGATGGTGGTGGCGCTGCTGGAGGTGTGGAAGGAT
AACCGAACAGACACTCTTCCTGAGTTTGATTCCAGTGTGT
CAGAGATTGTGGAGGACATATTGAAAATGCACGACACAAC
AAAACAAGGACATTTAACTCTAGAGGACTATCAGATATGG
AGTGTGAAAAGTGCCCTCGCCAATGAGTTCCTCAACTTGC
TGTTTCAGGTGTGTCATATTGTCCTGGGCCTGCGTCCTGC
CACCCCTGAAGAGGAAGGCCAGATCATTAGGGGTTGGTTG
GAGAGGGAAAGCAGGCACGGTTTACAGCCCAGTCAAAACT
GGTTCCTGATCTCCATGCAGTGGTGGCAGCAATGGAAAGA
CTATGTCAGATATGATAATAAGTCGATTGTCATGGAGCAG
CCATCAGTGCAGGGCAGCGGGATGAGAAGTTCTCAGTCTG
CTGCATCTGTAGAGCCTATCCTCAACAGAATTGGATTAGT
GGTTCGCTCCCCCAGTTCCCCAGAAGAAAAATTCCCTGAC
AACATCTCCAGCTCATCAGAGGCTTCAGAGAGCACTGGTA
ATAGCCTAACCCCACACATCAGCTCCTCTGCCACAGACGT
GTGCTTTGCTCGGCAGCACAACATCTCTGACAACAACAAC
CAGTGTTTCTCAAGCGCCAATGGCCATTTGCCTAACAGCT
TGGCCGTGCAGAGACCCGGTGCGATAGACAACCAGCCTCT
GGTGACCACCGAGCCCATGAAGGCACCCACGCTGACTATG
GAAGGAGGTCGACTGAAGAAGTCCCATCAACTGTTGTCTG
GCCGGGAGTTTGAGACGGTTCCAGAGCCGGTGTGGAGAGC
ACTTTACCACTGGTATGGGGCCAACCTTAGTCTGCCCCGA
CCGGTTATCAAGTCTACAGTCAAGGCACAGCCTGAGCTAG
AGCTCTTCCCCCTTTACCTTCTGTTCCTGCGACAGCAACC
GGCCACACGGAGCCCTCAGTCCAACATCTGGGTCAATATG
GGTAATGTTCCTTCTCCCAACGCCCCGCTCAAGCGAGTGC
TGGCATACACAGGCTGTTTCAGCAGAATGTGCACCATTAA
AGACATTCACGAGTACCTGTCCCAGAGGTTACGCATCAAA
GAAGAGGACATGCGCCTCTGGCTTTACAACAGCGAGAATT
ACCTCACTCTCCTGGACGATGAAGATCACACTTTAGAAAG
CTTGAAAATTCCAGATGAACAGCACTTAGTCATTGAGGTT
CGAAACAAAGATATGAGCTGGCCAGAGGAAATGTCTTTCA
TTGCAAACAGCAGCAAAATCGACAGACACAAAGTTCCTAC
TGAGAAAGGTGCCACAGGTTTGAGTAATCTGGGCAACACG
TGCTTCATGAACTCCAGTATTCAGTGTGTAAGCAATACCA
AGCCCCTCACTGAGTACTTCATCTCAGGGCGACACCTTTA
TGAGCTTAATAGAACTAATCCAATAGGAATGCGTGGTCAC
ATGGCCAAATGCTATGGTGATTTGGTACAGGAACTATGGA
GCGGCACTCAAAAGAATGTTGCGCCTTTGAAACTTAGGTG
GACGATAGCAAAGTACGCGCCAAGATTCAATGGCTTCCAG
CAGCAAGACTCCCAGGAGCTTTTGGCCTTCCTGTTGGATG
GGCTTCATGAAGACTTGAATCGTGTGCATGAGAAGCCGTA
TGTGGAGCTCAAGGACAGTGATGGACGGCCGGACCATGAG
GTTGCTACAGAGGCCTGGGAAAACCATTTGCGGAGAAATC
GCTCTATCGTGGTGGACCTCTTCCATGGGCAGCTCAGATC
CCAGGTGAAGTGCAAGACCTGTGGCCACATAAGCGCACGC
TTCGACCCCTTTAACTTCCTATCGCTGCCTCTGCCAATGG
ACAGCTCCATGCACTTAGAAATCACAGTCATCAAACTTGA
CGGCTCCACTCCAGTGCGATACGGGCTCCGTCTCAACATG
GATGAGAAGTACATGGGGCTAAAAAAACAGCTGAGCGAGC
TCTGTAGCCTGAAACCTGAGCAGATCCTACTGGCCGAAGT
TCACACGTCCAACATCAAGAACTTTCCTCTGGATAACCAG
AAGGTGCGACACTCTGTCAACGGCTTCCTCTGTGCGTTTG
AGATCCCTGTGCCTGGTTCACCCACTTCAGTCACTTCTCC
TGTTCAAACAGAAAAACCACCTATTGCCAATGGGACAGCA
GGAAACAATCATATTGGAAAGTCTGGCCTGATTCCTAATG
GTATGCCCAGTACAGTGGTCCCCTGCACCCTTGAGAAACC
CCTCGCCAATGGTATCCCCAATGGCCATGCTGTGCCAGTG
CAGGACAGCCCATTCATTGGCTACATTATTGCCATGCACA
GAAAGATGATGCGGACGGAACTGTACTTCCTGTCCTCTCA
GAAGAACAGGCCCAGTCTGTTTGGTATGCCTCTGATTGTG
CCATGCACAGTGCACACGAGTAAGAAGGACCTGTATGATG
CTGTGTGGATTCAAGTGTCCCGACTTGCAAGTCCACTGCC
GCCGCAGGAAGCCAGCAACCATGCTCAAGACTGTGATGAC
AGTTTGGGCTATCAGTACCCCTTTACGCTGCGGGTGGTGC
AGAAAGATGGTAACTCCTGTGCCTGGTGTCCCTGGTACAG
GTTCTGCAGAGGCTGCACAGTGGACTGTAATGAAGACAGA
GCATCTTTGGGGAATGCCTACATTGCTGTAGACTGGGATC
CCACCGCCTTGCACCTTCGTTACCAGACGTCTCAGGAAAG
GATAGTTGAAGAGCATCCCAGTGTTGAGCAGAGTCGACGC
GCTCAAGCAGAGCCCATCAGTCTGGACAGCTGTCTGAAAG
CCTTCACCAGTGAAGAAGAGCTGGGAGAGGACGAGCTCTA
TTACTGCTCCAAGTGTAAAACACACCGCCTGGCCACTAAG
AAGCTGGACCTCTGGAGGCTGCCTCCTGTACTGATTGTTC
ATTTGAAACGCTTCCAATTTGTAAATGGTCGATGGATCAA
GTCTCAGAAGATTGTGAAGTTTCCACGCGAGAGCTTCGAC
CCCAGTGCGTTCCTTGCCCCACGGGAGGTGTCTCAGAGCC
TTGGCAGCCTGCAGAGCCTGCAGAGCGAGTGCCTGGTGGA
GGAGCTCCAGAGGCTGGAGAGAGGAGACTCCTCTGTGTCC
TCCATCTCCACCACCACCTTGGCCAGTCCTCCCATATCTG
GCAGAGCCACCCCGTGCTCCATCAGGAGGGTCGGCAGTCC
CCTGAGCAGAAACAGCAGTCCCGGCAGCAGCCCCAGAAAC
ACAGGCCGAAAACAGGGCCGCTTGCGTCTTCCCCAGCTGG
GCAGCAGACATCGACTCTGCAACAGCAAAGAAAACCTGGA
AGCCTGTAGCACCAACAAGGAGAGCGAGAGCGAGGCCGAG
CAAAGCGCAGTGACGGACGGGGAGAATCTGACCCCTGATG
CCAACACACAAGACACCTGGTCACTAGACGCCTCCAGCAA
CGACTGCGATGTCATTATGGTGAATGGACTAGGACAGGAC
AGCAGTCAGAGCAATGGACATTCAGAGGTCAGCGCCGATC
TGGACACCCCTCACCAAAGAAATGACATCTGCCTGGAGTC
CCTGTATAATTTATATGCAATCTCATGCCATTCGGGAATA
ATGGGAGGGGGGCACTATGTGACTTATGCCAAAAACCCCA
ACGAAAAATGGTACTGTTACAATGACAGCAGCTGCAAGGA
AGTGCACTCGGACGAGATTGACACAGATTCAGCCTACATC
CTGTTTTATGAGCAACAGGGAGTGGACTACTCGCAGTTTC
TGCCAAAAACGGAGGGCAAGAAGATGGCAGACACCACTAG
CATGGATGAAGACTTTGAATCTGACTACAAGAAGTACTGT
GTGCTGCAGTGACACCACATGAAGCTCTTCCACATGAAAG
ACACTAGAGGGGTCTGTCAGTATGCTGTACGCCTCGCCGC
CCCACAGGACCGCCATTTGTGAAAGCACAAAATATCAGTT
AGCCGACAGGCACGACACCGCCGCTGACTGCGCTTTCAAA
ATAGAGGTACCTGACACTGCAGATACACCAGGGAGAAGGC
CAACGAGTGACAACTGTAGCTCACCATCACGTGATTGTTG
CCAAGCAGACAAAAAAATATCTCCTAGCCAATTCCTCCAT
ATCAGCAGACAGACAGACCAAACTGCTCTTTCACATGCCA
ACCCACACAGGTGAATCCAAAAATCAAACACTGCTCAATT
TCAGAATGCTGATGGAGAAAACAGGTCCTTTTTAATTCGA
AAATGGTTGGTATGAATGATACGTTTCTCTCAAGGTTTTG
TTGGTTAATTCCTTTTTTTTTACGGTGACCGAAAGACGTT
AACGCTCTGGAATTTAAGAAAACACATGCATATACAAAAA
ACACTAGCAAATTAAGAAACGATCTTCATCAGTTTGACAG
CACACGTGTTGCAAATTCCCACAGTGCAAACCACTGAATA
AACGCACTGCATTTTGTCACAACACAAACAACTGAATTAA
CGCACTGCATTTTGTCACAACACAAACAACTGAAGAAACG
CGCTGCATTTTGTCACAACGCTTACAAATATCCATGTAAC
ATAACGAAAATGTTTCAAGGGGACCCAAAAACATGACGGA
CTCTGCTGAGATATGGATGTGGTATTATGCTGTGACTGTT
GCTCAGTCAAGTTGTCGGTGGTCTTTGAAATATTGGAATT
TTTTTGTTTGATTGCTATATTCCATTGTCTTTTGCACTTA
AACTTAAACGTTGCGTTATTAAAGTTGTTTGCGTAGTGAC
AAAATAGAGCGCGTTTCTTTAGTTGTTTGTGTTGTGACAA
AATGCAACACGTTTCTGCAATTGATTGCATTGTGAGAATT
TGCAACACGTGCGCTGGCAAACAGATGAAGATCGTTTCTT
AATTTGCTGGTGTGTTTTTGTAATCTCATGTGTTTTCTAA
AATTCCAGCGTGTTTAGCTTTCTCAGCCACCATACTTTTT
CCATAAGTTCCATACACTACCTCACATCTTTCATAATTTA
TTGGCCAACTGTTCATATAAAAAATCAATGACAGTATTAT
ATCATCCGAGGGCAGTTGAAATCATTTACTTTAATTAAAT
TGTCATCAAGAAAGATTTCTTCCAACCAATTGAACTATCC
TCCCTCTCCTCTGCTGCCAAATGATGCTATTTTTGTTGTT
TTAGACCTTATTTAAAATGGTTATTTCCAGATTTTGATTC
TCTTTAGAAGAGTATATGTAAATCTTTTTTCTTTTAAATT
TTTTATATGTTTATTTTATCTTTTTTTTTTTTAAATGCAG
TAGTTCACTTTGCCTAAACGCGTTCGCTTTCAGCTTTAGT
CTGACCAAACCATGTCCTTTCAACAAAAGCGCAGCTTTTC
ACACGTTTTCTTATTACCACTGTACGTTCTTGCTTCACAA
AATACTGTTGACCGCAGACAGAGACTAAAAACAGCTAGCG
GAAACATATCTTATGGATGAGACTCCACATGTCCAAGCCA
AAGTGTTGAACCGGTCATGTACATAGTTTGTGGCAAGCTT
CGAAAGCCGTTAGATGAGAGCGTCTGTCGCGTGAACAGTA
TTAGCACAGGAATCTTTCACACGCTTTGCTTTTAGAGAAC
AGCATTCTCGCTAAACTGCTGACGGTTGGGGATGTCTGTG
GCTGCTCCAGGTTATTAGTAGCATTTCTTCAGTGACTCTT
GCTGAAAGAGCCCACCTTAATTACCACTGTGAAAAGATGA
AATCTGAAATACTGAATGGCTCTTATTTTTCAGCGACCCA
TCAACCCAACGAGCTCCTCCTGCGAGGGGACGTTAAACCT
TTCAGAAATCATCGGGAATCATTCAAAAGCACCCATTTTG
CTGCTGTACTCTTCATGGATATTCTAAATATTTGCCATCA
AATAAAGGTGTATCCCTGTCGGAAAAAAAGAAATGAAGTA
AACACACAGCTGTATTAATCAACTGTCAACATTTTTAGGT
GTTTTAACGTTTAAAGAAAAAGAGAGATCCAAATTCAAAG
CTTCAACTGAAAATTGGCCGAATGGGGTTTTAAACATTGG
CTTTTTTTGATACAGGGATAATTTATTCAAATGGCAAAAT
GATCTCTTTTCCAAGTAGTGCAATCAACTACTGATACGTG
TGTCTTCGTCCATGTCGTTAGTCCTAATTTCTGTTAAATT
AATTTTGATGCTAGAGATGTATTAATTTAATGAACTTTAT
TTTGTAAAGTGTTGTTTAAAGAAAAACCGATTGACATTGC
ACTGACAAATGTACATAAATGTTTTGTAAATACGCCAATG
AAAACGATGATGTATTTGAAAATGAACTGTACAAATGTAC
TTGTAGTTGTATATGGAGTGACGACGTTGATCTGTAACAA
TTATTCAAGAAACGAATTAAATGCAGCCAAATGCGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
usp32-201 Contained in:
[Fosmid] CH1073-145M9 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000057386 (1),  Ensembl_Trans:ENSDART00000088808 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DN860285 (1) 662 bp
GenBank:EB927596 (1) 636 bp
GenBank:CR929506 (1) 539 bp
GenBank:AW058958 (1) 475 bp
GenBank:DT882770 (1) 424 bp
GenBank:EB992958 (1) 285 bp
CITATIONS (2)