Transcript

fam19a5b-202

ID
ZDB-TSCRIPT-131113-4213
Name
fam19a5b-202
Previous Names
  • fam19a5b-001
  • ch211-170j16.1-001
  • si:ch211-170j16.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056690 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056690|OTTDARG00000039490|ZDB-GENE-131127-365 fam19a5b|OTTDARP00000044460 CH211-170J16.1-001 LG_none CR854923.7,CU468860.5,CR759810.11 Danio rerio protein_coding PUTATIVE, 768 bp
CCGCATAGTTTCCTCTGGAAAGTCAGCAGAACGACGCTGT
CTGGACATATGTACGGTCTTTTTCTGGACTTTATCGGAAT
CCCGGGAGTGACGGCTGTTTGTGCTGCTAGAGGCTCGTTT
GCGGAAGTGTGACGGGTATTGGCTGGTAAATATTTCGGGA
CTAACAAACCCTGTGGTGAGCGAGAGACTATGCAGCGGTT
AACGGGACACGGAATGTCAGACGCCGCGTCCAAACTCTTG
CGTTGAACTTTAATCGCTTCGAACAATAGAAACCTGTCGC
ACACGCCTGCCTTTCCCGCATGGAAAGTGTCATCAGCTGT
TGCTGAGAATAAAGGAGTGTTTGTTGTGTGTTGAGTCGGG
ATGGATGTGCGGTTGTAGACGCGTCAGATCATCGGAAAGA
TGCAGCATCTCCGTGTGGCGTGGGCGCTCGCGGGAGCGGC
GGTGGGCTTTTTTCTGCTCTTCTTGATTCAAGCGCATTTC
TTCGGCGAAGGTCAGCTGGCGGCAGGTACATGTGAAATCG
TGACTCTGGACCGGGACAGCAGCCAGCCAAGAAGGACCAT
CGCCCGGCAGACGGCCAGGTGCGCCTGCAGGAAGGGCCAG
ATTGCGGGCACTACCAGAGCCAGTCCAGCATGTGTGGATG
CGCAAATTGTCAGGACCAGACAGTGGTGTGAGATGATGCC
TTGTTTGGATGACGAAGGCTGTGACCTATTGGTAAACAGA
ACAGGCTGGACGTGTGCACAGCCAGGAGGCCGAGTGAAAA
CAACCACG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations