Transcript

brd1b-201

ID
ZDB-TSCRIPT-131113-4212
Name
brd1b-201
Previous Names
  • brd1b-001
  • ch73-242c17.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056687 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056687|OTTDARG00000039487|ZDB-GENE-070209-98 brd1b|OTTDARP00000044458 CH73-242C17.1-001 LG_ CU570887.7 Danio rerio protein_coding KNOWN, 3829 bp
GTGCGTGGTGACGCAGTGCGTGAGGCGATGGAGAGCTGCA
GCCGCATTGTTGTGGGGGGAAGAGAGGCGAGCTAGCCTGC
TAGCACAGTGCCCATACGGCCAGCCCAAAAACGAATGAAA
AGAGGCGCGTTGGTATGGTTGAGCTGCTATTATCGTGAGC
CTGTAACTCCGGCTTTTAAATGCGTATTTTTGGACCTGAC
AGACCGTCACGGATACCGCATAATATCCTTGGAATACAAC
GGAGAAGCGGCTGGAGGACGGTAGCGCGGCTCGTGTACGG
ATTAAACCTACTGCTGTTCAGTAGGCCACACCGCTGCTGC
GTTTAGCTCGGCCTGTACTTCCTTTAAAGCTTCTTTTACC
GTCGAGGGCAAAGTTTGTCTGCGGCATTCAAAATGAGGAA
GAAAGTGAGACAGAACCGTGTCGCAACCCCACAGAGGCCT
TCCTCGCCCATCAAACCCTCACGCAACCGAGAGACCTTGA
CGTACGCTGAGGCTCAGCGTATGGTGGAGCTGGAGATTGA
CGGCCGCGTGCACAGGCTCAGCATTTATGACAAACTAGAT
GTCATCGACAGCGATGACCCTTTAGCTCAGGAGATCAGCG
AGTGCACCAGCAACAAGGAGAACACTGAGAAGCCGCAACA
GGTCCTTGTTCGCTCGGTGCGGCTCAAAAACAACCAGCAG
AAGAAGAGTGCCGCATTGACGAATGTGCAGGGTTCGCCAG
CTCAGGGCAGGCTACCAGAGCCAAAGATCCGAATGGTTGA
ATACAACCTTCCGGCTGTGCCGCGGAGGCCGTCAGTGTAC
TACACCTACATGGAGAAGACACTTGACGAGCTCGATGAGG
AAGTGGAATATGACATGGATGAGGAAGATTACGCCTGGCT
GGAGATGATGAATGAGAAGAGGAAGAGCGACGGACACAGC
CAGGTCTCTCAGAACGTCTTTGAGTTCCTCATGGATCGCT
TCGAGAAGGAGTCTTTCTTTGATAGCCAGGCTCAAGGAGA
ACCGCAGTCTCTTATTGATGAGGATGCTGTCTGCTGCATA
TGCATGGATGGCGAGTGCCAGAACAGCAATGCTATTCTGT
TCTGTGACATGTGCAACCTTGCTGTTCATCAGGAGTGTTA
CGGAGTACCACACATCCCAGAAGGACGCTGGCTTTGCCGC
CACTGCTTAAACTCTCCTTCCCAGTTAGCCGAGTGCATTT
TCTGTCCAAATAAAGGTGGTGCACTTAAGAGAACGGATGA
TGACCGATGGGGTCATGTGGTCTGTGCCATCTGGGTCCCG
GAGGTTGGTTTTACCAATACGCTTTTCATTGAACCAATTG
ACGGTGTGGCAAACATTCCTCCAGCGCGCTGGAAGCTCAC
CTGTTACCTGTGTAAGAAGAAAGGAGTGGGTGCCTGCATT
CAGTGCAGCAAGGCCAACTGTTACACGGCTTTTCACGTGA
GCTGTGCTCAGAAAGCAGGGCTTTACATGAAAATGGAGCC
CGTCAAAGAGGTCACTGAATCAGGAGGCACTACATTCTCT
GTGAAGAAAACGGCATACTGCTGCCCTCATACCCCAAACG
GTTTTGTGAGAAGGCCACTCACTATATATGATGACTCCAA
ATCTAAGAACGGTGTATGTCAGAAAGCTGCTCACAGAGAG
AGGGTGAAGGGATGCCAGAAGAAGAAGAACAAAAAGCCAG
AATCGGAGCCCGATACAGTGGTTCCAACGGTTTCTGGTCC
TAGTATTACTCCTAAAAGTTTCAACACAATCCTCAATCAA
GTGTCTGTCCAGAAGAAGAGGATGTTTGTGGAACGGGTTC
TCAGTTACTGGATGCTGAAAAGGCAGTCGAGGAATGGTGT
CCCGCTAATAAGACGCCTGCAGACTGCAATACAGACGCAA
AAAGATCCAGAAGATGACCCGTGTGTTGATGACCACCAAA
CGTTGACAGACCAGTTGAAGGACTTGCACCGCTTACGGCA
CGACCTGGAACGTGCTCGCTTGCTATTGGAGCTCATCCGC
AAAAGAGAGAAGCTAAAGAGAGAGGAGATGAAGTTGCAGC
AGTCAGTTTTGGAGATGCAGCTCACTCCGTTTCCTATTAT
TCTGCGGGTAGCACTGGATCAGCTGCAGGAGAAAGACCAG
GCCAAAATCTTTGCTCAGCCTGTCAGCGTCACAGAGGTTC
CTGATTATCTAGACCACATTAAGCACCCCATGGACTTCTC
TACAATGAGAAAACGCATTGACGGCCATGAATATCAGAGC
CTGGATGAGTTTGAGGAAGATTTTAACCTCATTATCAACA
ACTGTTTAAAGTACAATGCCAAGGACACATATTTTTACCG
CGCCGGTGTAAGAATGCGAGATCACGGTGGAGTGATCCTC
AGGAGGACTCGACGGGAGACAGAACGGATAGGTTTTGAAT
TCCCAAGTGGAATACACCTTCCTGAGCCTCCTAAATTAGA
GCTGCCTCCATCGTTTACCTGGCATGATGTTGACCGAGTG
TTAAACCCAGCTAATCGTGCGCACATGTCAAAGGATGAAC
AGTTGAAAAAGCTGTTGGAGATGCTGGATTTAACATTTGC
CATGAAGTCATGCCCTTCCAGAAGCAAACGGCTCAAACTT
CTCAAAAAGACCATTGGTGATGTGCGAATGGATATGGGTC
AGAAAACAGAGCCCCCTTCATTGGAGCAGAATAATACAAA
GGAAGAGGAAAAAGCGCCTCTTATTTTACCACAAGAGGAA
GAAGGTGACAAGTCCTTACCTCCAAAACTTGAGCCTTCTG
ATTCTGTGCCACTCCTGAAAAACTCAGACAGCCCCTGTGA
ACCTCCTACACTGAAGCCTATGGAGCCCAGCCCCGAAAAG
TGCCCGAAAAAGGTCAAATTTGACGGGGAGACATTTTCTA
CCTCACTTTTAAATGGTCTCTCCCCTGATGTCCTGCCCTC
CGAAAATAATGTTATGGTCGCTACCTCCACGCTAACCGAA
CCAGCAAATATAGTGAACCGGCGAACGGCTGTGCTCTTCC
GGAAGTCAAAGAACACAAGTCCACAGAAGCTGTTGAACAC
AAGCGAACCCTCAATTGACTGCCCTCAACTGGGTACAAAG
ACCTTTCTATCGGTGGTCATTCCTCGCCTTGAAACCCTGC
TCCAGCACAGGAAGAGGACGCACAGTGCAAGCGGAGACAG
TCCAGATGAAGAGGATGAGTGTCCAATCAAACGCTTGGAT
ACTGGCTTGTCTAATGGCTTTTCGGAGCCAAAGAAAGGTA
TAATTGTGACTCGACCATCAGAGCCTCGTCGACGCTGTGC
TTCAGAGTCCAGTATTTCTTCCAGTGGAAGCGGAAGCATT
CAGGAGAACTCAAGTGATGTCAGTCACACAAAGAGCGGGA
AAGGGAAGCTGGCGATGGCAAGGCGGAATACAACAGATGA
TAAAAAAGAACTGCTCAATTGCACAGAACCAGGGAACATT
TCCAAAGCCAACAAGCTGGCAGCAGATCATAGATCCTCAG
TTGCCTCGAGTGGGATGCCATCTCAACGAAGAGTACATTC
CCACCCCTCCACGGGACGTGCTCCGGGTCGGAGAGCTGAT
GCAGTTCAGGTCCAAGGAGAAACTCTTCCTCGTCCGCTTC
TTCGACAGCAAACGCAACTGGCAATGGCTTCCTAAATCCA
AGATGGTACCGTTTGGAATGGACAAGACCTTAGACAAACG
GAAAATGTTGGAAGGCAGAACATCAGGCATCCGGAAAGCT
GTGCAAAGCGCCTTCAACCGTGCCATGAACCACTTGAGCC
TTGTCCAGGACTTAAGCGCTGGAGATTAAGCCGTGTTGAA
GGGTTTTATCATAAAAAAAAAAAATCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations