Transcript

kcna6a-202

ID
ZDB-TSCRIPT-131113-4186
Name
kcna6a-202
Previous Names
  • kcna6-001
  • kcna6a-001
  • ch73-230f23.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056577 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056577|OTTDARG00000039404|ZDB-GENE-080722-21 kcna6a|OTTDARP00000044374 CH73-230F23.2-001 LG_ CU929369.7 Danio rerio protein_coding NOVEL, 2541 bp
ATCTGTTTGAGCTCTCGGCTGACCATGCTGCCAGAATGAC
TTCTGTTACTTTGAACCAATAAACCAGTGTTAAATACAGT
CTTAAGACGTTTTGGAAGGTGGTACAGTTTTAGAAATTAG
TATAGGACTCTATCTTAGCCAGGCTGGAGCTCTCAGATCC
TAAAAACTGGTGGAGTGGTAGCAAGTCGAGGAGGCACAAG
CAGCACTCCTCTCGAGGGGCTAAAATGTCCCGAGAGAACC
AGGATGATGGTGTGGACCATGTTGCCCTCTTACAGGACAT
CTGTGAAATGGAACAGTCTGACCAGGAGTGCTGCGAGCTA
GTCACCATCAACATATCAGGTCTGCGCTTCGAAACGCAAC
TTAAAACGCTTGCGAGGTACCCGAACACATTGTTAGGAGA
CCCCATTAAAAGGATGAGGTTCTTCGACCCACTGAGGAAT
GAGTTCTTCTTCGACAGGAACAGACCGAGCTTTGATGCGA
TCCTGTATTATTACCAATCAGGCGGAAGACTTCGAAGACC
CATCAACGTGCCAGTTGACATGTTCCTAGATGAAATCAAA
TTTTACGAGATTGGTGATGATGTCATCAAACATTTTCAAG
AGGATGAAGGTTTGCTGAAAGAAGACGAACGTCCCTTGCC
ATCCAATGAGTTTAAGCGTCAAATCTGGCTGTTGTTTGAG
CATCCTGACAGCTCGGGTGCAGCTAGAATTATTGCTATCG
TTTCAGTAATGGTCATCCTGATATCCATTATAATCTTCTG
TATAGAAACTTTGCCAGAGTTTAGAGAAGATGATCGGGTG
TTCGATAATCACCTTCCGGCAAACAGTACAACTTCTGTAC
AAAGATTAAGCGCATACACGGACCCATTCTTCTTATTGGA
GACTATTTGTATTGTTTGGTTTTGCTTTGAGCTGTTTATA
AGGTTTCTTGCTTGCCCAAGCAAGCCCACCTTCTTCAAAG
ACATCATGAACACCATAGACATTGTTGCCATTATGCCATA
TTTCATTACTCTGAGTTTAGAACTTGGTGAGGTGCAGTCA
AACCAACAACAGACCACATCTCTCGCCATACTGAGAGTCA
TCCGCTTGGTACGCGTCTTTAGGATATTCAAACTTTCAAG
GCACTCCAAGGGTCTGCAGATTCTTGGTCAGACCCTACGA
GCAAGCATGCGAGAACTCGGACTACTGATTTTTTTCCTCA
TCATCGGCATTATATTGTTCTCCAGTGCAGTTTACTTCGC
CGAAGCGGATGACCCAGAAACTTCTTTTACTAGTATCCCT
GATGCATTCTGGTGGGCAGTTGTTTCAATGACTACTGTTG
GATATGGTGACATGTACCCGGTCACAATTGGGGGCAAAAT
TGTTGGATCAATGTGTGCCATAGCAGGAGTTCTTACCATT
GCCCTTCCTGTACCAGTAATCGTGTCGAATTTTAATTACT
TTTATCACAGAGAGCACAACGAGGCGGATCAAGTGGAATA
TACACATGTAACCTGTGGCCGCTCGCTGCCTATGCAGTGT
GACAGAAATAAAAGTGACAGTAAATCCTCTCTCATGATAT
CAGAGCATTCAAATGATGATGCCTGTACAATATCAAGCAT
ATTAAATTTCGGGCCATCAGAGGACTACACGGGCAAACTC
ACAGACGTATAAGAAAACCACCTGTACCAAAACATGGCTC
CATGTTGCAGCAGAAGTATGAAGAATTTTCTTCTCTAAAG
AAGACAGAAGTTACTTTTACCTTTGTAAACATCCGCTGTC
TGCATTGTAAGTGTTTTTAAAGTCATATGTAGGCTGAGTA
TTGAAAGCGAGCTTAAATGAAGCATATAGGCCAGGTAACG
TTTAAAACGTACAAATTGATATGTATAATGTTTATAATGT
AAATATCTTGCGATCAATTTGGCAAAACCAGTGTATGTTA
ATCGATGAAGGAGGCTGATGGAATGATGACAAACGCTTTG
CTATTATTAACTGACGAATCCGACATTTACGTAAGTCAAT
GAAAAAAACATTTTTAAACCAATCAGCTTTCAATATCACG
TTATTACATTCAAATGTAGCCTTTTTCAGTCAATTTAAAT
GCATCAAGTTATCATTTGTTTACGTAATACATATAATTGT
CGGTTCCGCAATCAATATCAGCCTACATATAGGCTATTTA
CAATCCTCACCGGCAGATTTGAGATTTTTTTGTAATATAT
TGTAATATATTTGTAACTGAATGTTTATAAATTAATTACG
TTTTATTTAAGCCATCACTGTGTCACTGTCTTTATGAAAT
ATTGCTCTTAAAATATCTAAATGATTTCTGTCTTGTGTAA
GCTGCTTTTTGAATATGTTGCCTTTCCTCAGGATATTTTT
TAATGGTTTGACATTAGATCTTTGTTAACATGTTTTGACT
TGTTAACTGTTCACATGACAGCATGAGACCAATTCAGTGA
ACAGTTTTTTTTAACTTGTTATTTAATGAGATTTAAATTG
TTAACTTATTTTTGATAAATAAATGTGGTCACATTCATAA
ACTATCCTAGTTTGAACCCCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations