Transcript

ottdart00000053725

ID
ZDB-TSCRIPT-131113-417
Name
ottdart00000053725
Previous Names
  • ch211-209h5.2-001
Transcript Type
antisense
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053725 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053725|OTTDARG00000037564|ZDB-GENE-130103-1 cacna1ha|no_translation CH211-209H5.2-001 LG_ BX649356.19 Danio rerio antisense NOVEL, 606 bp
TTATTAGTTTTTTCTTCTTTTTTTTAATCTGTATACTCTG
TCTTTACAGAAAACGTCAGCTAGGCTCATGACAAAGAGAG
GAAAGACTAACAAATATGATACAGATATTACGTAACACTA
CACATCCTGAACTCAAATCAATGTGATTGAGCACTGGGAC
TAAAATAAGAACCAGAGTTCCATTCGGAAACCTGAAATTG
CATATCCCGTGTTCAACACCTTGCCCAATCACAGTCAGAT
CAAATGCTGTTCCGCACTAGGATCGGTTGCCATTTCTGGC
TGGCTTTTAGGATGATATTACATTTGAAGAAAAAACAAAG
AAAACTTTGGCTACAGAAAGAGGTCGTCATCCCCCGCTCA
ACTAGTTGCTGCACCCTTGAGTGCGGACGGTGAATCTGGG
TGTGGCTCGATATAAGTTGCCCTGCCTTCTGGTCCCGCAG
TGGCACTGGCTGAGATGGTGCTGAGACGGCGAGTTTCTTT
CAAAATTGCCAACTTGATCGCAGCATCCATTTCTGCATCC
TCTTTAGCTTCTTTATTGCTCTCCTCCAGATGTTTCATCA
ACACAGCTACGACCACGTTAACCAGCACAAACTGAGCCAT
TAGAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations