Transcript

si:dkey-276j7.1-201

ID
ZDB-TSCRIPT-131113-3672
Name
si:dkey-276j7.1-201
Previous Names
  • dkey-276j7.1-002
  • si:dkey-276j7.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054269 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054269|OTTDARG00000037911|ZDB-GENE-060720-44 si:dkey-276j7.1|OTTDARP00000042634 DKEY-276J7.1-002 LG_ BX950218.13 Danio rerio protein_coding NOVEL, 535 bp
AATGAAGAAGAGCAGAATCTAGGCGTCCCCCTTCTCAGCG
CTGCTTTACACGACAGCTACCTAACCACCACTGACCACTG
AAACACCAGTCATGGCCGCCGAGCCCAACTATCGCCGGAC
GAAACCGGCTCAGAATGCTAGTTCAAACGGAGCAGTTGGA
CCCTCGTCCCAGATCCCAGGTTTGTCTGCAACTGCAGAGA
CCACTCCCGAAGAAAGGACTAAAGGACGCCGCGTGGGGAT
TCAGGCCTCAGACTCGGATTATGTGAAACTTGCAAAACAA
GGAGGACAGAGAGGTTTGCTGTGGCATGATGACCCTGTGG
AACCAATAACCAACAGTTCCTACAAACCATCTAATTGGTT
CTCTGGCTCACCTGATGACAACAGAAGTAAAGCTACTAGT
CCTGACGGAATGAGCAAGAGTGAGTCTAAAGGGGCATTAC
AGCGACTGGAGCCCCCTTTTGGAACTGATAACGGTTCAGC
CTGGGATTCTGATAAAGACAAGAATGTCAGCTATACTGCA
GCAGAGATGGAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations