Transcript

sema5bb-201

ID
ZDB-TSCRIPT-131113-3670
Name
sema5bb-201
Previous Names
  • sema5bb-001
  • ch73-336h19.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054251 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054251|OTTDARG00000037900|ZDB-GENE-130530-778 sema5bb|OTTDARP00000042623 CH73-336H19.1-001 LG_ CU658611.17 Danio rerio protein_coding NOVEL, 3295 bp
GGCAGCGATGGTGTTCTGGGCCGGATCACTGTCTTTCGTC
GGACTGGTCATCTTTCACCTCCTCTTTCTGCCTGTGGTCA
CGTCACAGACACCATCATCACCCCCAGACACCCCTGACCC
GCAGCCTGAAGAGTGCCGGAGAAAAATGCACCCTGTTACC
TCCTACACAGCGTTGAGTCCGTGGCTCTTCTCGTTCTCTG
TGCCTGGAGTGAACGACTACTCACCACTCACACTCGACCT
CAGCAGGAGCCAGCTGATTGTGGGAGCCAGGAATCATCTC
TTCCGGCTGAGTTTGAGTAACATCTCTCTTCTGCAGGCCA
CAGAATGGGGTGTTGACGAAACTACCAGGAGATCCTGCCA
GAGCAAAGGAAAGACCGAGGACGAGTGCCAGAATTATGTG
CGAGTCCTCCTGCTGAACGGCAGTCGTTTGTTCACCTGCG
GTACGAACGCCTTCATGCCCGTCTGTGTGACGCGTCCCGT
GACGGACATCAGCAGCGTTCTGGACTCCATCAGCGGTGTG
GCTCGCTGTCCCTACGATCCTCGACACAACTCCACAGCCA
TGATCACAGAGAGCGGAGAGGTGTACGCCGCCACTGTGAC
CGATTTCTCTAGCCGGGACCCCATCATTTACCGCAGCCTG
GGGAACATGCCGCCTCTGCGCACCGCACAGTACAACTCTA
AATGGCTCAACGATCCTCACTTCATCTCGGCGTATGAGGT
GAGCCGTTTCACATACGTGTTTCTGCGAGAGAACGCAGTG
GAGCAGGATTGTGGGAAGACGGTTTTCTCTCGCGTGGCTC
GCGTGTGTCAGAACGATATCGGCGGTCGCTTCCTTCTGGA
AGACACGTGGACCACATTCATGAAGGCCCGGCTAAACTGC
TCACGATCTGGAGACGTTCCCTTCTACTACCATGAGCTGC
AGAGCACTTTCTATTTGCCCGAACAAGACCTCATCTACGG
GGTCTTCACCACCAATGTGAACAGTATTGCTGCGTCAGCC
GTGTGTGCGTTTAACCTCAGTGCCATCACTCAGGCCTTTA
ACGGGCCTTTCCGCTATCAGGAGAACCCTCGCACCAGCTG
GCTGTCCACTCCAAACCCCGTCCCAAACTTCCAGTGCGGG
ACGGTGAATGATTCGGGGCCGGGTGCTAATCTGACAGAGC
GCAGTCTTCAAGACGCCCAGCGGCTCTTTCTGATGAGCGA
CGTGGTTCAGCCCATCTCCACAGACCCGCTGGTCATGCAG
GACAACATCCGCTTCTCCAAACTGGCGGTGGACATCGTTC
AGGGCAGAGACACGCTTTACCACGTCATGTACATCGGCAC
AGAATATGGCACCATCATCAAGGCCTTGTCCACTAATAAT
AAGAGTCTGCGTGGATGTTATTTGGAGGAGATGAACATTC
TGCCGGGAAACAAGCAGGAGCCCATCCTGAACCTGCAGAT
TCTGCACAGCGATAGATCTCTGTTTGTGGGGCTTCCCAGC
AGAGTGTTGAAGATCCCTTTGGAAAGATGCTCTAACTACA
TCACTGAACAGGATTGTCTGGGTGCCAGGGATCCGTACTG
CGGCTGGGACCGTAAAGAGAAGCGCTGCACCACCATTGAG
GACAGCTCCAACATGAGCCAATGGAGCCAGGACATCACAA
AGTGCCCTGAGAGGAACCTCACTCAAGATGGCGGCTTTAG
TGATTGGTCAACATGGCAGGCTTGTAACCATGATGACGGA
GGGGAAGGCATCAGCACATGCCAGTGTCGCACCCGGGCCT
GCGATCACCCTCGACCCCAGTGTGGAGGACTAAAGTGTGT
CGGGGCTAATATAGAGGTGGCCAACTGCTCCAGGAATGGA
GGCTGGACACCCTGGTCATCCTGGGCCGAGTGCAGCACCA
GCTGTGGGATTGGGTTTGAGGTCCGTCAGCGATCCTGTAA
CAATCCTTCACCTCGACACGGAGGACGCGTGTGTGTAGGC
CAGGCCCGAGAGGAGAGACTGTGTAATGAGAAGAATCCAT
GTCCTGTCCCGATGTCCTGGGTCTCCTGGAGCGCCTGGTC
CAAATGTAGCGTGGCCTGCGGTGGTGGAGTCCAATCCCGC
GTTCGAACCTGCGAGAATGGCAACACGTGTCCTGGATGCC
CTCTGGAGTACAGAGCGTGTAATTTGGACTCGTGTGCTGA
AGTGAGGCGAACGACACCGTGGACCCCCTGGTATCCTGTT
AATGTGACCCAGCTGGGAGCGCGGCAGGAGCAGAGGGTCC
GATATACCTGTAGAGCTCTGCTGGCAGACCCTCATGACTT
ACAGCTCGGCAAACGCAAGATAGAGACACGCCTCTGTCCC
ACCACTGACGGAGCTGCTGCCTGCGAGACTGATGGTCTGG
TTGAGGATTTGTTGAGAATGGGTCGACCTGTAACACGAGT
GCAAGGAGCCGCCTGGGCATTATGGGAAACCTGGTCTACA
TGTTCAAAAGAATGTTCCAAAGGCTTCCGCACACGCAAAC
GCTCCTGTGCCGCACCGGATGGCAAGAGCACACCGTTCGC
CTGCAGCGGAGCCCCGGTCGAGTATCAGGACTGCAACACT
CAACCCTGCCCAGTGAAGGGGGCGTGGTCATGCTGGTCTT
CCTGGTCTCAGTGTTCTACTTCCTGTGGTGGCGGTCATCA
CCAGCGCTCCCGTTCCTGCTCGAACCCTGCGCCGGCTTAT
TCTGGAGACATCTGCATCGGCCTGCACACAGAGGAGGCGC
TCTGTAACACACACGAGTGTGAAGGTGGGTGGGGGGCGTG
GTCAGAGTGGGCAGAGTGTAATGGGGAGGGGCTTCAGCTC
CGGGCTCGTACATGTGAAATAAGCCCCGCCTCCTGTCTTG
GAAACTCCACAGATCAGAGACAGTGTCGGCCCAATGAGAG
CGCAGTGCTGTCAAAAGGACAGAAGAGGAGCACAAACTGT
GGAGGGTTTTCTCTGTTCCACCTGGTTCTGACTGGTGCAT
GTTGTTTTCTGGGAGCCGTTTTACTCTCCATCCTGGTCTA
TGTGTACTGTCAGAGACTCCGCAAACCTCCGCAAGAATCT
GCAGTCATCCATCCCAGCACCCCAAACCATCTCCACTATA
AAGACAACAGCTGCGCGCCCAAGAACGATTTATACACACC
CATGGAGTTCAAGACTCTCAATAAGAACAACCTGCTTCCA
CCAGATGAAAGCTGCAACTTCTTCCCATCGCCCTTACCAC
AGACCAACGTCTACACCACCACATATTACCCGTCTCCGCT
GGGCAAATACGACTTCCCTTCAATGGATTCCCCCTGCAGC
TTCATGCACAGCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations