Transcript

zgc:162952-203

ID
ZDB-TSCRIPT-131113-3031
Name
zgc:162952-203
Previous Names
  • ch73-195i19.3-001
  • si:ch73-195i19.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059488 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059488|OTTDARG00000041217|ZDB-GENE-131127-583 si:ch73-195i19.3|OTTDARP00000047377 CH73-195I19.3-001 LG_ FP015972.7 Danio rerio protein_coding NOVEL, 3966 bp
AGAAATACTTACTGTGGTTTAATGGTGTTCAAACTAAAAC
AATGTATATTAAGACATTGATGATATACAGTATGACATGT
CATTATTATCAGCAATGAGGGGTTGGCGGCGGCAGCGCAC
TCCATTGGCTTGCAGTTCATTCAAACGGATCTAGATCCTG
AATGTAAGACAGTTTATCAAAATGACGGTCCCTGGCATGT
TTGTTTAGTTTATTGCGGTACCACGCGCTCCCGATTTCCT
TGTATTTCTCCAGCTTGACCATATATCACTCTTGCGTTAT
GTCTCTCAAGTTGTCTCGGGAAGCGATACCTCAAAAATGG
CGCAGTTGTGACGTCACACACAACAAACGCACGTGACTGA
CAAAGACCGATTAGCCTCTAAACCTCAGCAGAGATGTTTT
CCTCGTAACATCATGCGTTGCCAGATTGTGCGAGAAGAAA
TGCGTTTAAACAAGTAAATACATTTTTACCTGAGTTTCTA
ATAATGGTGCTGGTTTTGTGAACATTTTTATTATTATTAA
TAATAATAAAATGATTTGCTTAATCTTGCTACTGCTATTA
AAGAAATGTATCTCCTCATTAAATCACACTTTCGCTTCTG
TACACGGTATATCCCAATGAAATCTGGCAACTCTACATAA
AACACTCCCCCGAGATACTGTAAATATTTCAAATAATTAA
TCTAGCTCAGCTTAGCTAGTTCATGTTGTAATGAAGTCCA
CAGATAAAAAATACAAAATGAAACTACTTTAAAAGTGGGA
TAGCAGTTGATTTACTAATTATTCGTTCACTTTTACAAAG
GTTACGAGTCAAAACAAGTGTCAGGGGGGCTGGGCGTTGG
GCGTTTCTGCCGAGCATACGACCGAGGTTGGTTTAGCGTG
ACACGGAACTCTTCTAACTTCCCTCAAGCTTGTATCTCGC
CATGCGAAAACGATCGCGATTCAAACTTTTCACGTACCTT
GCTTTAGCTGGGTTAATAACACTTGTTTTCTTCGCTTTTA
ACAGTTTAGTATTTGATCCGTCTGTTCCGGGAAATAGTCC
TATCTCTAAAGAGCTATATAAAGTGATCTCACCTTCAACA
TACAGGTTTATACTGAACCAGCCAGAAGTGTGTGAGAAGA
AAACTCCTTTCTTAATTCTGATGATCCCAGTTACCCTCAA
AGACGCAGAGGCGAGGACTGCTATCAGGAGAACATGGGGT
CAAGATGGCTTAGTTCCTGGTGTGAGTATTTTGCATTTGT
TTGTCGTTGGTCAGCCTGCACGAAGTGACCCAGTATTGCA
GGAACACCTTCAGAAGGAGAGCAAGGAACATGGAGATATT
ATTCAGATGGATTTTGTGGACAGCTACCAAAATCTGACAA
TCAAAACAATGATGATTATGAATTGGGTAGCAACTTATTG
CCAGAGTGCTTGGTATGCCATGAAGATTGATGCTGATATC
TTTCTTAATGTCCATTACTTGGTGGACTACCTGCATGGCC
AGGGTGAATCAAGGAAAGACTACATCACTGGATCGGTCAT
TTCTGATGCAATTCCTCACAGGGACAGCATCAACAAATGG
TACATCTCTGAGGACCTTTACCCAAAATCCTGGTATCCAC
CATACGTTTCTGGAGCTGCCTATGTTTTTTCCACTGACCT
GGCTGGAAAAATATCATGGGCCTCAAGATTTGTGCAACCA
ATTCCACTTGAAGATGTCTATGTGGGGTTGTGTCTGGACG
TGCTGGGTGTAAAACCAGTTTATGCAACACAGTTTTTAGG
ACTTCGAAATCTTTTTGAGGTGCGCAGACTTAAATATGAA
AGATGCACTTTTGCCACACGCATTATAGTCAATGGTTTTA
AGCCAAAGTATCTTATTCGAATCTGGCATGACTTTCAGAA
GTCTCATTTTGCATGTTGAAAACAAATTAATTATATAATT
ACCAGTGCACTATAATTAAATAGAAAAAAATTAATTATAA
TAATTACCAGTGTTGGGAAAGGGCGAAGCAGTGGCGCAGT
AGGTAGTGCTGTCGCCTCACAGCAAGAAGGTCGCTGGTTT
GAACCGCGGCTTTGCATGCTCTCCCTGCGTTCGAGTGGGT
TTCCTCCGGGTGCTCCGGTTTCCCCCACAGTCCAAAGACA
TGCTGCAGGTGAATTAGGTAGGCTAAATTGTCTGTAGTGT
ATGAGGGTGACTGGCCCAGACGACAGGCCGGCCGGAATGT
GTAAAAAAAGTCGTTATCATATGGACAAGTCTAAATAGAG
ACTTGTTCCAAAGAGTCGACCCCGCAATCATACGGGACTA
AGGCCAAAGAAGAAGAAGAATTACCAGTGTCGGGAAAAGT
TACTTTTGAAAGAAATGCATTACAATATTGAGTTACCCCC
CCCCCCCCCCCCCCAAAATAGCTAGTTGTGTTACTTTTGT
TACTTTTTATTACCTGGCTTGATCTCTTTGAGAAATAAAT
GTTTACTACTTTTGTACTATTTGTCTTAAATAGAATCACT
GTTCATTGAGACAATCCCCTTTTCCTTTTCTTTGATGCGT
TCATTAATGAACACATTCTCATGGACTGCATTTTGACTAC
TTTAATTTTAATTCAGCAATGTATGTTTTTAAAAGCGGAT
TAAACTAAAAAGTAACTCATATATTATTACTTATTGTTTA
TAAGTAATGAGTTACTTCACTCATTACTTAGTAAAGTAAT
ATCAAATCAAATCACTTTTATAGTCACATCATAAGCAGCA
CTTGTACTATAATGAGTGAAATGCTTAGGTGCTGGCTACA
AACGGTGCAAAATACAGACAGTGCAAAATACAACAACAAC
ATACTCCCAAAAAAACAAAACAATATACAATTGGCAATAA
ACATTATGTAACTTGCATTACTTGCAATGTGTTACCTCCA
ACACTGATAATAACACATAATAAACATAAATAGTCATTGT
TATGCAAATAGAAATAGAGCATCTACTGGGTTAAAGTGGA
GATTAGAAAAACTTTAGATAACAGAAACCCAGAAAGGCTT
TTTTTCACAGAAGGTGAAAAGTCCTAATATGAATGACAGT
CTCTTTTTATTGGCAGATTATTGGCTAAATAATGTGCCCT
ACTAAAGCTCCATTTGTTTAAACTAAATGCTTGTGCTCCT
GTTTTTTTCTCTATGTGTGTGTATTAGAATATTAAGTAAA
GATCATGTTCCATGACATATTTCATAAATGTCCTGCTGTA
AACATATATTAAAGAAACTTTTTGATTATTTATATTCACT
GCATACTTGTATCTCTGCCAAATATTGTCATATCATAACA
TATGCATCTGTGGAAAGCATATGTATTTGACTTTAATGTG
AAGTATAACCACTGGTTTTGTGGTTAAGAGTCACATATAC
AGTATTCAACATTTGAAGTGAATCAAAAATGGTTTTCAAA
AATTGTCCTAGGAAAAGAATGAATGCTGTTCAATAGTTTT
AGGACAACTTTGATTAAAAGTGATACTTCACTTCAAATGT
TGACTACTGTATAATGAATATATAAAAGAGTATTGGACAG
ATATTTACAATTTAAATACATAAAATTTTACTTATTCAGC
TAAAGACTGCATTTTGTCCTTATTGCCACAGTTGCTCGGT
ATAGAACATTTGATCATCAAGCAGATCACAAAAAGTCAGG
TGCAAAATGTAAACAAATGGGGGCGCTCTTTCCTCAGTAA
TGTCAAGAGGAAATAGCTTTTAAGTTTTTTCAGGATGCAC
TTTAGCAATGCATTATTCACTGAAAGATTGCATGCTTGAT
ATTTGGTGTATATTTTATAATCAACTCAGCTCTGTGCTGC
ATAATGATGTCCTGTAAATGTACCAGCCTGAGAGCCTGTA
TAATGTAGCAGATAGGATTAGTATTGCATTACGTGGTGTG
TTAGCGCCTGGAAATCTGCTGTTCAGACACAAAGCATTTC
GCTTTTATATACACAATAAAAAGCAATTTTAAGTCCTTTA
ATTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations