Transcript

si:ch73-40a17.3-201

ID
ZDB-TSCRIPT-131113-2905
Name
si:ch73-40a17.3-201
Previous Names
  • ch73-40a17.3-001
  • si:ch73-40a17.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058859 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058859|OTTDARG00000040807|ZDB-GENE-030131-5797 si:ch73-40a17.3|OTTDARP00000045964 CH73-40A17.3-001 LG_ CU928013.12 Danio rerio protein_coding KNOWN, 2800 bp
CGACACTGTTAAGCTGATCTCAGATCTGCCAGTTGTTTTG
AGCTTCATAACTCAACATGAGGCACGAGGACGCCACACAC
ACGCTCATATTTCTCGTATATTTATTATTATTTGTGTCTG
CTCGATGTGAGGTGACACAACGTCTGATTGAATGTGTAAC
ATCATCTACAGAATATAATGTAGACGGCGGTAAAGAGGAT
CTGTTTGACGTCAATGAAGACGCTGGTCTTGATCTTTTCG
AGGGAGATATTTTATATGATGAAACACTGGGGAGAAACTC
TATTATCGGCGAGGAATACAGATGGCCCAAAACTATTCCC
TATTACTTTGAGGACGATCTGGAAATCAACGCTAAAGGAG
TGATCCTGAAGGCCTTCGAGCAGTATCGGCTGAAGACCTG
CATCGACTACAAGCCCTGGACTGGAGAGGAAAACTACATC
TCTGTGTTTAAAGGCAACGGCTGCTTCTCATCAGTGGGGA
ACCGGCGTGTGGGCAGGCAGACTCTGTCTATCGGCAGCGG
TTGTGATCGTATCGCCACCATCGAGCACGAGTTCCTGCAT
GCGCTGGGCTTCTGGCACGAGCAGTCGCGCTCCGACCGGG
ACGATTACGTCTCCATCATGTGGGACCGCATCACAGAAGG
CAAGGAGCACAACTTCAACAAATACAACGACAGCAGCTCG
AGTGCGCTCAACGTGCCGTACGACTACAGCTCCATGATGC
ACTACAGCCAGAAGGCCTTCCAGAGCGGCTCCGAGCCCAC
CATCATCACCAGAATACCGGCCTTCAGCAGCGTCATCGGC
CAGCGCATGGAGTTCAGCGACAGCGACCTGCTGAAGCTCA
ACAGACTCTACAACTGCACCAGCTCCTCCACGTTCCTGGA
CTCCTGTGACTTCGAGCTGGAGAATATCTGCGGAATGATC
CAGAAGGGTGAAGCCGACAGTACTGCAGAGTGGCGGAGAG
TTCCTGAAGCTGCGGGAGGACCGGACACGGACTACACCAA
CATGGGCCGCTGCGAAGGTAAGGGTTATTTCATGCACTTC
AGCACGGCGGGAGGGCCGGAGGGGGCCAAGGCTCTGCTGG
AGAGCAGGGTTCTGTACCCGAAGAGAGGCTTCCAGTGTCT
GCAGTTCTTCGTCTTCAACAGCGGACACACTTCTGACCGG
CTACGCATCTGGACACGAGAGTTCGACACCGAAAACCCCA
ACGGAACGCTGCGTCTCGTGCAGCAGATACATGCTCCTCC
AGGCGAGCGCTGGCAGCTTCAGCACATCAGTCTGAACGTC
TCCAGAAAGTTCCGTGTGGTGTTTGAAGGCACTAAAGGCA
CCGGGAGCTCCGGCGGACTCTCAATAGACGACATCAACCT
CTCAGAGACGCGATGTCCTGATCATGTGTGGATCGTCCGG
GACTTCAAGAGCATTCTGGAGAACACACCGATGGACACGG
CCATCTACAGCCCGCGCTTCACTTCCAGACTCGGATACAG
CTTCCAGATGGGCCTGTACCCCAATGGGACCGCGGGGAAC
CCGGGCGAGATGGGAGCCTATGCTCATTTAGTATCTGGAG
ATGCGGCAGTGGACGGCGGGCTGGTGTGGCCTGCGCAGTG
GAAGCAGATGACCATGATGATGATGGACCAGAACGCAGAT
ATCCGCAGACGCATGTCCAACCAGAGGAGCGTGACCACCG
ACCCCAACATGACTGTGGAAGGATCTCTGAATCTGTTCTG
GGATGATCCACGTAAAGTTGGTGTGAAAGTGACTGATGAC
AATGGGACGGAGTATTTCCGAGGCCCAGGCGCCGGGACCC
CCGTGTACCTGACCCAGGCCAGAGCCCTGAGCCGGGACTT
CATCAAGGGTGGAGACGCCATATTCCTGCTCACCATGGAG
GATATCTCTGATCTGGTCGCTTCACAGCCTTTACCGTCCA
CAACTGTGACTCCAGCAACATCGGCTCACACCGGACCCAC
AAACCCAGACAACAGCACTACAGCCAGCCCGGCCACACAC
ACCAGCTCCATTACACACACCAGCGCAGACACACACACCA
GCTCCAGCACCACCAGCTCCAGCTCCAGCACCACTGTTCC
TCCTCCTGACCCGTGTGTGTCGCTGCAGTGTGAGAATGAT
GGAGTGTGTGTGCAGGACGACGCAGGACAGCCCGTCTGCA
GGTGTGCGGTGGGCAGTGACTGGTGGTATTACGGCGAGCG
CTGTCAGCACAAGAGCTCCACTCGGCACACAGTGGTGACG
GCGGTGCTGGCGGCGGGTCTGACGCTGCTGCTGATGCTGG
CCATCACCGCGGTCAGTGTGGTGTGTGTGAAGAAGCGACG
CAAGACTGTCAAACTGGACACACACGACATCACCATGCAC
AACATACACTCCAAAGCCTGAACACACACAGGGAGACGCT
GATTCTGGACGCCTGTCTGTTCTCTTCAATTAGAGAGCTG
CCATCTGGATGCAGACCTGGTGCAGATGCAATATGAGCTG
CATGCAAGGCTTTTTAATGCGCTCCCCTAACTCCGCCCCT
CTCAGTGATGTCAGCAGCTCCATTGTCTGTCAGTGCATCA
CTGATATCTGCAGTCTCAGCTTGCATCATCAAGGCTGCGT
CCAGATACTGTTGATCTTTGTGTGCGTTCTGGAATATTGT
ATTAAAAATGCTTCATGGAAACACCAAGATGCGCATCTGC
TTTAAAATGAAGAGTCTGATGTGCACAACTCAAATACACT
GTAGCTGTAAACTGAGCTGAGATCAGCTGGAGTGAGAATG
TACGAGTGCTGAACACATGCTATAAACTCTCTGAAAGGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations