header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-2788
Transcript Name: si:ch211-167j9.5-201
Previous Names: ch211-167j9.5-001, si:ch211-167j9.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057385 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057385|OTTDARG00000040006|ZDB-GENE-131121-210 si:ch211-167j9.5|OTTDARP00000044974 CH211-167J9.5-001 LG_ CR848814.7 Danio rerio protein_coding PUTATIVE, 1422 bp
GCATTTTCATCAATACGTTAACTAGTAATATGTATAAAAT
AAAACAATATTTTTAATACATTAAGTCTCTGTTTCCTCCG
CAGATATCGGTCATTGAAGAAGACCATAAGGGACCTGAAG
CAGGGGAGGCCGACTGTGATCCCTCGAGCAGCTTCTCATG
ATTCTTCACCTCCGTCCCCAAATGTCCTGACTCTTCCAGA
GGCACCAGAGCCAATCGCAGAGAGCCCGTTACAAAGACAA
CAAACCAAATCCAGCTGCAAGTTTCCTTGGAAGACTTCAC
AACAGGTTCCACGGTTCACAAAAGAAGACCTGAACCTTAT
TCAGCTTATAAAAGCTGGCAGAGAAGGAGTTTTTTACAAA
GCAAGGATAATAAGAGGCACTTGCAGAGGCCACTCGCTGA
TTACGTGCAAAATTGGAAAAGAAGGTATGACGTCTAAACA
GATGGAACATGAGGCGTCTATTATGAGAAAGCTGGCGTAT
CATAAAAATGTGATGCAGCTGCTGGACTGGAATACGGCGG
AGGAGCCGTATTTGCTGATCATGGAGTTCATGAGCTACGG
GACTCTTCGCACATTTGTTCAGAAACACAAAGATGAACTA
AGTGCAGACCCAGAATTGCAACGCCATTTCACGATTGCGT
CCTACCACATCGCCATGGGCATGGAGCACTTACGCTCCAA
AATGGTGGTGCACTGTGACCTTGCATTAAGGAACATTTTG
GTGGGTCGGTTTCCATGGGAGACGAAGGTGGCTGAGTTCG
GCTTGGCCAGAGACTTGACCCGCATGAGGAGCAGACGCAG
CAGCAGGAAAAAACAACACAAGGAGCGTGTGCCCCTGCGC
TGGTACCCTCCAGAATACTTCCGGAGCAACTACTACAGCT
TTAAAGGAGACGTCTGGGCTTATGGTATTGTGCTGTGGGA
AATGCAGATGTTCGGCACCTTGCCATACTCAAACTTAAGC
ACGTCTGAGGAAGTGGTGTACAATATCTGTGCTGGACTAA
AGAACCCAATCCCCAGAACCTGCCGTCCTGAAATGGAACA
GATCATACGGGACTGCTGGTCGGATCCATACACATCTAGA
CCTTCATTTACAGACATTGTCAAGATCCTGGAGAATATCG
TGGAGAGCGATGGGGATTACGTGCACATCGACAACCAAAT
GATCTTGAATGCAGAAGGGATTAATTAAGCAAAACAACAC
ATCGTTCTGAACATCAAAAATCTCATTCTTTGTATGCAGG
CATACTTTTTGTTTAACAATGTTTGCAGTTAAGAATTTAA
TTGTATGTAACGCTAACAGCCAAAAGGCAGTATTATTGAC
GCGAGTCATTTTATAAAAAATTTCTTCTAAATAAAGTCAG
TGTTTTATTGTGATTAATTTGCTTTATTTTAACACCATGT
AATTTAATAAAAATATATTTTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-167j9.5-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000057385 (1),  Ensembl_Trans:ENSDART00000153843 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CR928339 (1) 539 bp
CITATIONS (2)