Transcript

si:dkey-52d15.2-201

ID
ZDB-TSCRIPT-131113-2777
Name
si:dkey-52d15.2-201
Previous Names
  • dkey-52d15.2-001
  • si:dkey-52d15.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057309 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057309|OTTDARG00000039944|ZDB-GENE-030131-1342 si:dkey-52d15.2|OTTDARP00000044916 DKEY-52D15.2-001 LG_ CR626907.15 Danio rerio protein_coding NOVEL, 441 bp
CACCGAGATCATGGCTCTGATTGTTAGCTGTTGTTTAAAA
GGGTTCTTCCTGATCTTTATCCTCTTCCTCTGTGTCAATG
GAAATAAAACAAGACCAATCTTCATGGTGACCTTTCCTGC
CGTGATTGAGTCAGGATCTGATGCCAAACTGTGTGCAAGT
CTTCTAAAGCCCAACAAAACCCTCTTCATGAACATTTATC
TAGTTCATAGTAACCAGAGCACATTATTGCTGCAGGAGAA
AGCTGAGCAAGAGTTTCACCGCTGTTTTAACTTTCAGGCT
CCTCTAGCAGAAGCAGAATCAGTGCAGAAAATCAAGGTTG
AACTTCAAGGAGAGTCCTTCAACATGACTGAAGAGAGAAA
AGTCATGTTCAAATCATACCATCCTCTGACTTTTATTCAG
ATGGATAAACCCTTCTATATTGCTGGACAGACTGGTAAGT
T

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations