Transcript

slc6a14-201

ID
ZDB-TSCRIPT-131113-255
Name
slc6a14-201
Previous Names
  • slc6a14-001
  • ch211-158f7.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050443 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050443|OTTDARG00000035448|ZDB-GENE-130411-2 slc6a14|OTTDARP00000039597 CH211-158F7.1-001 LG_ CU459075.11 Danio rerio protein_coding NOVEL, 2000 bp
ACTTACCTGTTGCTCTTGAGACTGTGCTTAAGTATGAAGG
ATTACAGCTTGAAGAACATTAGAGGAGTACTATTCAAAAA
CTCAGTTGGAGATGAACAGGATAAAGATAAATCTGACAAG
GCTGAACATGTTGTACAGAATGATGAAAACTCTGACAGGG
GAAACTGGAGCAGTAAAAGAGAGTACATGCTGTCTATGAT
TGGTTACGCTGTTGGTCTTGGCAATGTTTGGAGATTTCCT
TACTTGGCTTACAAACATGGAGGAGGGGCCTTCCTCATCC
CGTACACTATCATGCTGGCTGTTTCTGGTCTGCCCTTGTT
CTTCATGGAAAGCTCTTTTGGACAGTTCTGCAGTCAAGGC
CCCATCAATGTGTGGAAAGCTGTGCCCATACTGCAAGGTG
TTGGCATCACGATGATGCTGGTTAGCACTTTTGTGGCGAT
CTACTATAATGTGATCATTGCATACAGTATCTACTACCTC
TTTGCATCTTTTCAAGATCCTCTGCCCTGGAGCATTAAGA
ACTGCAATACAACAGCCTCCAACATTTCTACTGCAGCAGT
GAATGTGTCCTGCGGTCAAATCTCAGGCCAGAGCCTCAGT
GAAAAATACTGGGATGAGGTGGCTCTTCAGCGCAGTAGCA
GTATGGATGAGACAGGGCCGGTGGTCTGGCATCTGGCTCT
TTGTCTTCTGCTCTCCTGGATACTAGTGGGAGCAGCTCTT
TTCAAAGGCATCAAGTCCTCTGGAAAGGTGGTGTATTTCA
CAGCTACTTTCCCTTACATCGTGCTTTTGATCCTGTTGAT
TCGTGGTGCAACTCTCGAAGGTGCGAAAGACGGCATCGAG
TTTTACATCGGCTCACAGTCTAACCTCACCAAACTGGCTG
AGGCTGAGGTTTGGAAAGATGCAGCTACTCAGATCTTCTT
TTCTCTGTCCATCGCCTGGGGTGGTCTGATGGCTCTGTCG
TCTTACAATAAGTTTTACAATAACTGCTACCAAGACTCTA
TTGTGGTCTGTGTTACAAACTGCGGCACCAGCATCTTTGC
TGGTTTTGCCATCTTTTCCGTACTTGGACACATGGCGCAT
GTCTATCAGAGACCAGTGTCAGAAGTTGCAGATGCTGGTT
TTGCACTGGCCTTCATTGCATACCCTGATGCTCTCTCTAA
GCTGCCCATTTCACCCCTGTGGTCAATCCTGTTCTTTTTT
ATGCTTATTACTCTCGGCTTGGATTCCCAGTTTGCAGGAA
TAGAGGTGATCAGCACCTGCCTCCTGGATGCCTATCCTGA
AGTTTTGAAATCCAAACGAGGTCTTGTTACAACAGCGGTC
TGCATTATTCTCTTTCTGCTCGGCTTGCCATGCGTCACCA
GGGCAGGAATATACTGGGTGAATTTAATTGACACATTTAG
TGCCGGATGGATTCTCCTGGTTGCTGGATTACTAGAGGTC
TTGGGTTTGTGCATCCTGTATGGTGGTAATCGCTTCATCA
AGGACATTGAGATGATGATTGGGACCAAGAGCTCCCTCTT
CTGGTTGTGGTGGAGAGCTTGCTGGTTTTTCATCACTCCA
GTGGTTTTGTCTATTATTCTGATATGGTCTTTGTATACCT
TTACATCCCCGACATATAGCTCAGTTGCATATCCTGATTG
GGGCATTTCTCTGGGCTGGTGTATCACTGCATTTAGCCTC
ATGTGGATTCCTATTGTTGCTGTCTGGAAAGTGTGTAAAG
CGAGAGGAGGACTGTGGCAGCGTATCAAATCTGCCTGCTC
TCCTACAGAAGACTGGGGTCCTTACCTGGAGTGTCACAGA
GGGGAGCGCTACGGTACCAGAGGAGAGACTGATCCAAATA
TATTTGTAATCTCAAACAAAGTCTCTACTAGATTGTAAAA
TATTTTAGTTTGAACAAGTATTTGTACATATATTGTATAC
AAATCTAGCACACTTGTCTCTTTCTAATTTAATACACAAG
ATAAACATGTTTTGTAAATACACATAATCCTTTTGTTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations