Transcript

lgals3bpb-201

ID
ZDB-TSCRIPT-131113-204
Name
lgals3bpb-201
Previous Names
  • lgals3bpb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049940 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049940|OTTDARG00000035136|ZDB-GENE-040426-2262 lgals3bpb|OTTDARP00000039192 lgals3bpb-001 LG_ CU570690.8 Danio rerio protein_coding KNOWN, 1994 bp
AGATGCTTTGTAAGTCATTCAGTTGTGAATTGCATCCTTG
TCGTTGCTGTTTCTGACATCATGTTGCTCCTGTGGCCTCT
ACTGTTTCTTCAGGTTTCTGCACTGCGCCGGACCTTGTTT
GACCGACCAAAGCAGCTAATGCAGGAGGGAAGAGTGAGAC
TGGTTGGAGTTATTCCCTCGTCTGGCCGTGTGGAGGTCTA
CCATGATGGACAGTGGGGTACGGTCTGTGATGACGGATGG
GATCTGGCCGAAGCGCAGGTGGTGTGTCGTCAGCTGGGTT
TTCCTGGAGCCGTATCAGTTGCTACTGGAGGACAATATGG
TGAAGGATCTGGTCGAGTCTGGCTGGATGATATGAACTGT
AAAGGCTCAGAGAGCTTATTGTCTGAATGCAGCTTCAAAG
GCTGGGGTGTTTCTGACTGCACGCATAAAGAGGATGCAGG
AGTGATCTGCGCGCCTGGTAAAAACACAACCAGCATTCGA
CAGATGTCTGTGGACAACAGTCTGGGATTGTCAGATGATC
TCGGTCTTCTGTTTGACAGTGAAGACGGTTGCGATTTCAC
CATTGCTGTTCGAGATCTCAGTGAAGAGGCTGAATTGACT
TTTTGTGTGCACCGTGTGATCCTCATGATCTATCCAGAGC
TAAACTTAACACATGACACCAGAAACATCACGGTGGACAT
CAGCCAGACTTGCCATACTCATGTGCCGAGATTTCTTAGG
TATTTGTACACCCGTCAGATTGATGTCTCTACAACATCCG
CTCAGTGTCTCCATCAGCTGGCGTTCATCTTTGGAGTGCA
GAAGCTCATGGAGGATGTTGGCAGGGTCTTCACTGCACTC
ATTCCTGAAGACATCACCTTCCAGACGCAGGTGTCAATGT
ACGAGTATGGCGTGCGCACGGGTGACCTTGTCCTCCAGGA
GAACGTTCTCCAGTATCTTTCCTGGAACTGCGAGTTCCTC
ATAAGCTCTCCAGTGTGGAGCACCGTCTCCTTTGACATGA
TGGATGCTCTGCTTCAGCGCTCAGACCTGATTGTGAAGGA
TGAAGCTGTTCTTCTTGAAGCTCTGGAGAGATGGATCCAA
GACAAAGGTGACAAGATTAGTTCAGATAAACAGGTCAGCC
TCCTGAATCACATCCGCTTCCTCTTAATCCCGGTAGATAA
ACTCTATGACATCCAATTCTCCTCAAGTGCTCTCCGGCAG
AGTAATGAGAAACTGTATCTGACTGGACTGCTCAGAGGTT
TTCAGTTCAATGCTCTTCCCTTCTCTAAGATCAGAGATCA
AGTTGTTAAATTGAGCGGTAATTATATCCCCAGAATCTAC
ATTGGAGATGAGTGGAGTCTCGGTTTGAATGTGAGCACTG
TCAATAACCCACATTACAACCCTTATCAGTATGGATATGA
CCAAAGGTATGGCCAAAGTAACAGAATAGAAAAATACTTA
TCCACTCCTGCACACCCTAGTGCTGTGTACAGAGGGCAAA
TGATCCAGTGGCAAGCCCAAGTTTTCCGTAGTGTTCAGGA
CTGCCGAAATAGTGGCATTTCATGCAATTCGGTGCCTCTT
GTAAGATTCCTCGCAACTAGCAGTCAGTACAGTTACTCCA
GCACCATTCGCTACAACAACCGGTTGGTTCTTACCTGTAA
AAATCAGAACAATGTCTTCCATGTGCAAGACTTCAAAAAC
AACATGGCAGTGATTCCAACTAACAGCAGCATGGGTCTGC
CGAACCCCTGTCCAGATGACTACAGCTTCAGATTTGTCGT
GCGCCCACAGTACATCTGAATGCTCAGCGATTTGACCTTT
GAGTTTCAGTTGAATCAATTCTGCTAAATTAAATCGAGTC
TCTTTGTATTAAAAATCGTTTTCATTCTTGAGTGATTTCT
GTGATTTGTTTTAGTTGATTTTAAACCTTTCATTACTGTT
AATTAAAAATAAATATGCTTAATTTTCATGCTTAGTGTGC
GCATCAAAGACAAAATAAAAAGGTTCTTTCATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations