Transcript

lim2.2-002

ID
ZDB-TSCRIPT-131113-1958
Name
lim2.2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052694 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052694|OTTDARG00000036981|ZDB-GENE-060124-1 lim2.2|no_translation lim2.2-002 LG_ CU929402.10 Danio rerio protein_coding KNOWN, 501 bp
TCAGGGTTTCTGGCTCTGCTGGCATTGTCCATCTACACAG
GAATGACCATCAGCTACTTCGGCCGTCGCTACATCGACTG
GCGTTTCTCCTGGTCCTTCATTCTGGGCTGGATTTCCGTC
ATTCTGGCTCTCGCTGCAGGAGTGCTGAAGGTTTGTGCGT
ATCAGAGAAGTGTTTCTGAAGCGACGCCTGTGAGTGTTTC
TGACAGCTGAAATCCTTCACATGCACATGATCAACATTAA
TAAACACTGCTGACTCTCACTGTCAGACTGTTCATTACAC
ACACATATATACAAACACTCAGAGTTATCGTCTGTAATAC
CATCTGTCCAGCAGAGGGCGATCACTGGACAAATACACAA
ACACATGACGTTCACAGAACTGTTACATCTGGTACTAGTC
ATTAACCAGGGGTTTCAGGACAGCACTTTCACACTTGACC
AACTCAAATATTCAGTAAAATCATTTAAACGACCATATTT
TTAAATAAAATAATTTTTTCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations