Transcript

znf1035-201

ID
ZDB-TSCRIPT-131113-132
Name
znf1035-201
Previous Names
  • dkeyp-84f3.7-001
  • znf1035-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000048588 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000048588|OTTDARG00000034354|ZDB-GENE-050309-241 znf1035|OTTDARP00000038114 DKEYP-84F3.7-001 LG_ BX539313.4 Danio rerio protein_coding PUTATIVE, 9208 bp
TGTCTGGTGTTTGTGCCTCGAGATGTACTAACATCAAGCT
CTTAATTATCTATTTTAAATCAACGAATTGCTTTCTAAGT
ATCTCCATATGCTGCTTTGAAAGTTTGGAAATAGCGTTCG
TGCGCATTGTGCCACGGGAAGGTAGTCTTTCAAAGGACCA
CGACAACAGCAGGAAGCCGAGCACGACGAGTGGATGACAG
AAGAAAAAGCAGCTATCACAGGAGTGAGTCTACTTTTGGA
ATGTGTAACGATAGTGGCATATTAGGGTCTTTGGGCAAGT
CACCTATAATGTTCCCACAGATATGTATCGGATAAGTGAG
AGTTTGATAACTAATCCATGGAGGAGAAAACAACGAGGGC
TAATACATAAAATGCACCCCTGCAAACACAGATTCTATTT
AGCCAGATCCCAGAGACTTCTGTAGGAACTATGGAATGTA
ATGGTATTCCTGCAGAATCGGAGGACACCTTTGCACATGA
GATAGAACAATTAATTGAGAAGGAGAACTTCTCAAGCATG
ATGGATTTGCAAGACATTGCTGATTCTGACATGAAAGATT
TTGAGTCTAGTTCTCTGCAGCACACATGCTTTGAATCATC
TTGGCAAGATGTGATAAATGCACCTGATCTTGAACCAGAT
AAAACAGAAGATAAAGGAGAATATAATAGTAACATGACAC
CTTGTCCCTTGCCCAACTCGGTAGAGGTTGAATCCACATT
GGAAACAAATTCTGACGAGGTGTTGTTAGAAGCTGCATTT
GAAACCAATGCTGGTCTGGTAGAGTATTCTGATATAAGCA
GCTGCTCTGACTCCGAAACAAATCTTGATTGCAATTTGAG
TTCATCCATTAAAGATGACATTAGTGGCAACCAGGCTGAT
CAGTCTATAGAGGGAAGAGACCAGAATCTAAGTAATACAA
TTGACTTTTCTGCTGAAGTTTGTCATGGTGCTTTGGAGGC
AGATATGAGTGGCATAGAAATGCAGGACACTAGGCCTACA
GAGACCATGGAAGAGAGCAAAACTGAAGAAGTAAGCTATA
CTGGCAGTAACTGCAGTGAGGGCTCAGTTCCTGTGAATGC
TGATCATCCATGTACAGAAATGCAAAGTGTGGATAGCCCA
AACAGTGTGGAGCCTTTGTCAAACGATGTGCAAATTGAGG
AGAGAGATGTTCATTCTTGTGATGTGGAGCAAACACTGGA
GCATTGCAGAGAACCTGATACCTCCAATGGTGGTTCCATG
TGTGCCTCAGATAATGCAAATGTAGAGACCTCATTCATTT
CTAATGGAAATGAAAACTGTTCTGAAATATGCCCAACTGC
AGATCCCCCAAATGATTGTCAGTTGGAAAAGACAACCCCA
GATACTGAAAACAAATCATCAAAACCTGAATGTGAAGATA
CATCTGTGATTTCTGGGAATGGAAAAGATTTACCTGAGGT
TTGCCAGTTGGATAAAATGGACCCAGAGCCTGAAAAAGCA
TTACTAATGCCTGAAATTCATAAAACTGATGAGATATCCA
ACTTCGAAAATGATTCACTTGGTGGCTGCCAGTTGGACAA
TAACCAACCAGACCCTGGATGTGCCATTCCAAATCTTGAT
CTGGAAAATTCTACTTCACTGGAGGTGCAAAAACATTTAA
CTTCTGAAGATGAACATGTTGAGCGGGGAAGTTTCGGATT
CCTTGAGTCTTGTTTTGGTTTAAAAAGTGCATCACAGAAC
ACTGAGGAATTGAGACACCTGGAACATGCACATGTAAATC
AAGTCACTGATTGCAATCAGTTGAATTGCACAGAACCACC
AGTTCTACTAAAGATTGCTATTGAAGCTAATGATCAGAAA
GATGAAGCCAATCTACAAGAAGATCCTCCAGCACTTAGTG
CTGTTCAAGGTTCTGAGAACTCTCTAGTTCCTGGACCACC
AATATGTCTGACTGGAAGTGGCACCAATGCAAGCAAGGAT
TCACTATCTTTGTTAAAAACCCAAAAGAGAAAGCTACAGC
CTGTTGTTGTCCTTAAAACAACGGAACAAAAAACATGTGA
TGGAAAAAATTTCCATTGCTTTGATTGCAAAGAGTCAATG
CATAGTGTAGATGAGCTAATTGAACACTATCACTGCATGC
ATTCTTTCCATAAGGCTGAATATTGTCCTACTTGTCAATG
TTTTTTGACTGGTGATGCATTGGCAAAACAGCATTTCTGT
GGAGAAGTTGAGCTTAATGACAAGTTAAAATCATCAGCCT
CGTATACAAAGAACCTAACTGGGGAGAAACCAAAGTACAA
ATGTAGGTACTGTGGGAAGATCTTTGTTAAAAAACCTTAT
TATGTACTTCACGATCTGAAGCACAGAATTGTCACTGATT
ATAGATGTCCCCGTTGTGGATTATACTTTCCTACAGATAG
CCAATGTCAATCACACCAGCACAAAATACGATGCACGCCC
TTGCTACTGGAACCTTCTTTACAGACTGCACACTCATCAA
AATCAACTCTTAAAAGGAAATATATTCCAAATGTCATTGA
AACTGCAGACTCCGATGTAGAACTTCGAAATTGCTATGTG
AAATTATTGGATGTTTACAAGAAAAGTGAGTCACCTGAAA
AAATACATTGTCAAGTTTGCGGGAGGAATTTCAGGCTCAG
AGCACAACTGAAAGCACACCTTAGATCACACTCTGATGAA
AAACCATTTAAGTGTGACTGTGGAAAGGCATTCAAATATA
CTTGGAATCTAAACAAGCATAAAAAACAGTGCTTTCAAAA
GATCATCCCTCATTCAACCATGTCAGATTCAGAAAGCAAG
ACTCCAAAGTTTAAATGCCCCATATGCTTTCGCCTTTTCA
ATTACTTTTACAATCGGACACGCCATTTACGTGAACAGTG
TCTTAAGGAATACATGAGAAAAGGCAAAGGGAAGGTTGAT
GATAAGTATCGTTGCCCTTTTTGTAAAGATGTGTTTACTA
TGGCATGCAACCGCAATAGGCACATCAAGCAAACTTGCGT
CAAGCTTAAACTCTACACAGCAAAAGTAAGGAAAAGAAAG
GAGTTGATATTTTCGTCTAAGAAAAATGAAAGCAAAGAGT
CACTGGCTGTGACCTCACAAAAAGTATTGCGGTACAAATG
CACATTTTGCTCGGCTATGTATTCAAGCAAGTCTGGTTTC
TACACCCATCTTGCGAAACATAAATTGCTTGGAAATTCCA
AAAAGGCAATCAAACACAAAAATGGTAGTGATGTTCGTTT
AAAAGGTTCAAACTCTGCTGATAATAGCTCAAACCATCCT
TTCTCTTGTCGCTTTTGTGGAAAGAATTCATCTTCATCTG
ACGCGCTAAAAAAGCACTTGAAACTTCACAAAGGAAACAA
GCCTTTTCGCTGCTTAGACTGTGGGAAAAATTTTTCCAGA
CATGGGCATCTGATCTCTCACAAGAATGTGCACAAGCGAA
ATATACAGTGCTTAGTCTGCTGGGAAGTTTTTTCATCAAT
TGGAGACTTGTTAAATCACAGAGAGTCTCATCCAAATAAA
GGCCTGCTTAAGTGTCCTGATTGCCCATTAAAATTCAGGT
TTCCAGTATTTTTCCTTCGACATGTGGCTGTGCATGAAAG
ACGACACAAACTTATGGCACCTCCTCCAAAAAAAGTTACA
ACTCCAAAGGACCAAGCTCCATCCTGGAAGGCAGAAGAAA
CTTGCGAAGAGGAGTTTAAATGTCGCCTCTGCCAAGAAGA
CTTTGCTGACTCGAAGGCACTTAGTGAGCATTGTTCAATT
CATATCCCTGCCTCAACTGTGTCCAAATGTCCATTCTGCA
AAAGCAGTTACTCAAGTCATGCTGTTCTGATTCGTCACAT
TCGTATTCACACTGGTGAAAGGCCTTTTCAGTGTACAACT
TGTGGCAGACACTTCAGCAGAAAGGAATATCTTAAAGTAC
ATGAGGAAAAATGTCAAGTAGAGCAACCTCCTTCATTGAA
GAAATCAAAGTCTAAAAAAATAAAAGCAGAACGCAGTGTG
GACACAGCAATCAACCAGACCAGCAGGCCTTATTTTTGCT
CATACTGCCCACATGCTTTTCGTTTTTCGAGTAATTTGAA
ACTTCACGAAAGAGCCCACTTGGCAAAGACAGTTATGCCT
TGTTCAAAATGTGGGAAATACTACAGAAAAAGAAAATATA
AGGAACATGTGGAGCTCTGCAAAGGAGGTCAATTACAACC
TTCTTGCAGAAAATGTGGAAGAGTTTTTACCAGAAGAAAC
TACCGAAATGGTCACGAAAAGCAGTGCCAGGGGAATCTGC
CAGCTGAAACCATAACTGGAACAAAGGAAAAGCGCAACTT
AAAGCATCAATGCCCTGAGTGCTCTAGATGTTTTAGATCT
AGCATTTTTCTACAGAGACATCTTTCTCTTCATTCAAAGG
CAATGCCATATTCATGCATGCGTTGTGGGCAGAAATTTGG
AAGCCAGCATCGATACTTGCAGCACGAAGCTTTTTGTAAT
GGTGTGTCCAAGCAGCGTAGATTGGAAAGTTTAAAAGGAT
CTGAGAAAATCAAATCAATCTGTGCCGAGTTAAATAACTT
GAAAGATGTCACTGAAGAAAATGGTGAAGATTTGAAGTGC
AATTTTTGCACCAAGACATTTTTGTGGGCCAAAAGTTTAA
GACGCCACATCCTCACTCATACAGAAGTCAAGCCATACCA
ATGCAAGAACTGTAAAAGTGGTTTCTCTCGCTATGATCAT
TTGAAATTGCACCAAGCCCGCTGCAGAGGAAAGAAACAAC
TTGAGGTGAGAGTACTAAAGATCAATCTTGACCGCTTAAA
CGAAAGTTCTCAAAGTCAAACGCAGCAAGATAATGAACTG
CAGTGCAAAGTTTGCCTTAAGGTGCTTTCCACTCCAAGTG
ATCTACGACGTCATATGGCGATGCTCCACATTACTGATAA
ACCTTTTCCCTGCAAACGATGTGGCAAAACTTACAGTTCT
GAAAAAACTTTGAAAAGGCATAACGACACCATCAAATGCA
AAAGGATTCCAAAGGTAACTGTGAAATCTGCCACAAATGT
TCAAAATCAGCCATGCAGAGAAACTTCCAAACTTTTGCAG
CGTATACAAGTTCACTACATGAATAAATTGAAATACCAGT
GTGACTATTGTCCTCGACGCTTTAAAATGTCAGGACAACT
GAAAGTCCATGAACGTCTTCACACCGGGGAAAAACCATAT
GGCTGCGCCAACTGTGGAGAGCATTTCATCAGAACAGACT
ATTTGAAACGACACTTGGCCAAATGTAACGGAAGGGTAGA
AAATCAAGAAAAGGTGCTTTGTGACAAGTGTGGTGACCTG
TTTACCTTTGAAGCACTATCTGTACACCAAAAGACTTGTG
TTGTGAATTCAAAATCTCCTGGATCTTCTCGTGTGGTAAA
AAAGGACAAGAGCCCCAACAAGATAAGAGGTTTTTCCTGT
GCTAACTGTAGTGCCCGTTTTATATTGTTTTCACAGCTCC
AACAGCATTTTTTGGCAAAGCACAGGTCTGATCAGCCACA
AGTGACCATTAACAATCAACAGCAATTGGTATCAAGTCAA
CAGCAAGTCATAAAGGAAGAGACAGTTGATGAGGTGCATG
GGCAGAAACAAGAAAGCAGCCATGAGGTATCTCGAAGGGA
GCCACGTGCACGTTCAAACATAGAGATTATGAAGCCTCTC
AAATGCCCACAGTGCAACATGCGGTTTTCCAGGAGTACCG
GGCTAGGTATGCATATGCGCATACATAACGGAGCGTACCC
GCATTCTTGCACAAAATGCCATATTGGTTTTTGGACCAAA
AAGACAATGGAGAAACACAAGAGAAAATGTAGAGGTCACA
CAATCATCTCAAACAATGCATCTGTCTTGGAAAGTGCAGG
TGACGTAGAAAGTGCTCTAAATGACACTGTGCTAGTATTT
AACAAGGGTTGTAATGCCACAGGAACTGGAGTACTGCAGA
CTAAGTTCTCATGTAAAGATCAAGACCAGGAAAATTATGC
TGAGAAAGGAGATGCTTCTGTTCACAAGTATCAGTGTTCT
GAGTGTGATCAGAGTTTTACAGATGGACTGAGACTTATAA
GTCATTTGGAGGAACATGGCCGTGAAGAACAAAAGCGCAA
ATCAGATGTTCACAAATGCCATGTGTGCAGTAAAGTCTTT
GCTCAAGCTGGTATTTTGCACAGGCATTTGAGAGTTCAAC
ATCAGGAAAAAGTGGATTACACATGTAATATTTGTTCCAA
GAAATATCGTTTTCCTTCAGACTTGGATATCCATAAAACT
TACCATGACCCTAGTCGCCCCCTTGTTTGTACTACCTGTC
AGATGCGGTATTGGACTGAAAAAGCCCTGGCCCTTCACCA
AAGGATGGCTCATGGACATGTGCAACCACCAAATTCAAAA
GAATCTGGCCTGAAAGCAAAAACTGAGCAAGTATATAGAT
GTGAACCATGTGACAAAACTTACACAATCAAAAAATCATA
CATAAAGCACTGCCAAGTAAAACATAAACCGGAATCAGTC
CAAACTCCCAATGATGAAACAAAAACCTCTACCAGTGTTA
GTCAGGCATCGGATAAGGAAGAGTCCGACAGAAATTTCGA
AGATGATGATGACAGTGACAATGACTCTGATTCAGCACCC
TACTTTCCCTGTCATGTTTGTGGCAAAACATTCTTAACAT
CGGAAAAACTTGAGGATCATCAAAGATGTCATCTTGGTGA
AAAACCCTTTGAGTGTGAAGAATGTGGGAAGTGCTTTGTT
CAGCTAACAAACTTGCAGCAACATCAGCGATCCCACAAGT
CTGAGTTTCAGTGTCAAATGTGTGGTAAAGGCTTTACCTC
TCTCTTTAGTCTGCGCAAACACAAGCAGATGCATGTCAAG
AAGAGTGCTCATCGCTGTACCAAGTGCCACCTGAGCTTTA
CACGTTCAACTGAACTAGCTGAGCACATGATTACCCACCG
TGATGAAAACTTTCCTTGTGACCTTTGTGATGAAACCTTT
TCCTGCAAAACAAGTCGAGCTGAGCATCGCAAGATGCACA
CAGAGCAAGAAGAGGAACTTCCACCATTGATTCCACCCAA
GCAGCCTGAAACAAAGAAGGTGACTACAGCTATCCACAGT
AAGAGTCTTTCATCAAGTAACACTGAGCAGTACAAGTTTC
GCTGTGGAATTTGTCAACTAAGATTTCCAGATCCAGAACA
GCTCTCAGAACATGGATGCAATCCAGCTAAAGAGCGTCCA
TACTCATGTCCGGAATGTAACAAGCATTTCTTACATGGTT
CCCACCTAAAAAAGCATCAGCTCAGTCATCAGCTGTCAGG
ACCACGTTGTTATCGGTGTAACCATTGCAACATGAGCTTC
ACACAACACCACCTTTTTCTCACTCATTTAAGAAGCCATG
GAAATGAGAAGGCTTCCAAGAACAGCAACTTTGCAACCAG
TGAAAAGATGGTCCATGTGGAAACCAAACGTGACAAAATT
TACCAGTGCCCCATATGTCCTTTGAGTTTTTACCAAGCCT
TGGACCTTGCAAATCACCTCTCTGTTCATTCTCATATGTG
CAGTGTTTGTAATATGACCTTTCCCTCTCAGAATGAGCTT
GACGAACATGAACAGTGCCATCTAACTGCTGCTACGCAGT
ATGAATGCACAGAATGCGGAGACCATTTTATTGGAAGTGA
TGCTTTCCGCAGGCACCGCTGTAGTAATCGAAGTTTGACA
TTTTCAGAAAAGCATCGTTCAGAGTCTTCTTCCTCTTACT
CTAAGAATCAGAGTTCAAGGACTCTCTTTCAAACAGGTGA
CGAAGAGGAGGAGGTTGATGTTGGAGAGGACTTTATTATT
TGCCCTATCTGTAAAAAAAGGTTCTCTTCTAATAGCAGTT
TAATGGAGCACCATAAAAAGCATCATGAGGAGCCACGTCC
TTTCAAGTGTTTGGTTTGTCAAAAAACCTTTACGAAAAAA
CGGTACCTTACACAGCACCAGCAGACACACAGTGAACGGC
CTTACCAATGTGAAGTTTGCTCCGAATCTTTTAAATCCGA
AACGACTCTAGCAAGTCATTGTAAAATACATGATGCAAAA
CGGCAGTATCAGTGCCACATATGCAGCAAAACCTATCTTA
CGTCAAAAGATCTCGCAAAACATCAACAGAAACATTCTGA
AAACCTCAGATTCACAGCTCAGGACAGCAGAGAATACCGG
TGCGATATGTGCAATAAGTCTTTCACTATGTTCGCTCATT
TGCAAAAGCACCAGGAAACCCATGTAGGTCAAGTGGTCTA
TGAGTGTACGGAGTGTGACAAAGCTTTTGCTTTTCTACAT
CTTTTAGAGGAGCATCAAAAAACTCATGCCGCTTCTGTTT
CCATAGATTCAATTCAGTCCCAATCACCAAGCCATTTCCC
CTTCCAGAGCCCAGTAAATGAATAAATTAAAATGCTCAAG
TTTCCTGCAATGCAGGTTATTCAATATGATTCAGTTTTCT
GAACGATATTTAAAATTAGGTGTACATACAATTCTTTTCT
TTTTTTTTCTATGCCAAACTGCTCTTATCCACTTTTGACA
TATTGCATTGGTGTTTTACTTCTAAATCAGTCTGCTAATG
TTACCAATCTACTGTTTTACAGTTCTGTGAACTGCTCACT
AAATTCTTTGTACAGTGCTCAGACTGATGTGTATAATAAA
TGTATGCCAGTTAGATGATGTATTGATCTGTAGGAGTATG
TGCATGAATGAGGTGGTTCCAAACCGGATGTATAGTTCAG
AATTACGCCTCATTCCTTCATCGTTGAAGTCCTGTTTGAC
TTTGCTAGATTTACTAGCCATTTACTGTTTTTAAACATCC
TTTTGAAAGTAATAGGAAATCTGTAGATTCATGTTAATAT
TTTTTATTATCCTTGTGTTTCTAAACATTTAAGGTCCAGT
TAAGGGGTTATTGAATATTAGTTATCCATATTGTTCATGT
CTTTCTAAGTTGGAAAGTGTATTTTGTTACTTAAAAAACA
TTTACCTTTTTATTGAGTCTAACTTGGATGTTTTTACTCA
AAGTAAACAGCAAAAATTAGGCTTGACACATAATACTGTA
TTTTTCTGTATGAGTTTGAACTACATTAGTGCTGCCATTT
CTGTCTGTGTTAACCTGGTGTTTAGTTTTACTTTTGTATT
ATATGGCAATGTTGAGGATTTCTTCAACTAGTAAAACAAT
TACATCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations